Warning: mkdir(): Permission denied in /home/virtual/lib/view_data.php on line 81

Warning: fopen(upload/ip_log/ip_log_2024-12.txt): failed to open stream: No such file or directory in /home/virtual/lib/view_data.php on line 83

Warning: fwrite() expects parameter 1 to be resource, boolean given in /home/virtual/lib/view_data.php on line 84
Complete Mitochondrial Genome of <i xmlns="">Echinostoma hortense</i> (Digenea: Echinostomatidae)

Complete Mitochondrial Genome of Echinostoma hortense (Digenea: Echinostomatidae)

Article information

Korean J Parasito. 2016;54(2):173-179
Publication date (electronic) : 2016 April 30
doi : https://doi.org/10.3347/kjp.2016.54.2.173
College of Animal Science and Veterinary Medicine, Heilongjiang Bayi Agricultural University, Daqing, Heilongjiang Province 163319, P. R. China
*Corresponding author (chunrenwang@sohu.com)

These authors contributed equally to this work.

Received 2015 August 5; Revised 2016 January 16; Accepted 2016 January 23.

Abstract

Echinostoma hortense (Digenea: Echinostomatidae) is one of the intestinal flukes with medical importance in humans. However, the mitochondrial (mt) genome of this fluke has not been known yet. The present study has determined the complete mt genome sequences of E. hortense and assessed the phylogenetic relationships with other digenean species for which the complete mt genome sequences are available in GenBank using concatenated amino acid sequences inferred from 12 protein-coding genes. The mt genome of E. hortense contained 12 protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA genes, and 1 non-coding region. The length of the mt genome of E. hortense was 14,994 bp, which was somewhat smaller than those of other trematode species. Phylogenetic analyses based on concatenated nucleotide sequence datasets for all 12 protein-coding genes using maximum parsimony (MP) method showed that E. hortense and Hypoderaeum conoideum gathered together, and they were closer to each other than to Fasciolidae and other echinostomatid trematodes. The availability of the complete mt genome sequences of E. hortense provides important genetic markers for diagnostics, population genetics, and evolutionary studies of digeneans.

INTRODUCTION

About 500 species of echinostomatid flukes (Echinostomatidae) had been reported in the world [1], and at least 20 species belonging to 8 genera can infect humans [2]. Among these genera, Echinostoma is the largest one, which constitutes 7 species, including E. hortense, E. angustitestis, E. cinetorchis, E. echinatum, E. ilocanum, E. macrorchis, and E. revolutum [2]. Although the majority of people infected by echinostomes have no obvious symptoms, severe infections may cause anorexia, lower extremity edema, anemia, weight loss, and dysplasia [3].

The adult worms of E. hortense often inhabit the small intestine of humans and many animals [3]. The parasitic fluke E. hortense was originally described from rats in Japan [4], and since then, it has been reported in South Korea and China [2,3,5,6]. In addition to rats, it has also been found from cats, dogs, and pigs [6-8], and more importantly, there are many infected human cases in China, Japan, and South Korea [2,3,9-11]. A high prevalence of human infection by E. hortense was reported in Koje-myon, Kochang-gun, Kyongsangnam-do (Province), South Korea, up to 9.5% [11].

Mitochondrial (mt) genome sequences provide valuable genetic markers for investigating population genetics, systematics, and phylogenetics of animal species [12,13]. So far, there are about 18,000 species of digenean trematodes found in the world [14], but only 32 species have complete mt genomes sequenced. In the family Echinostomatidae, only 1 species Hypoderaeum conoideum (KM111525) had complete mt genome reported, and no mt genome of genus Echinostoma has been available. Previous studies on E. hortense have mainly focused on their morphology, life history, and epidemiological investigations [3-11]. However, the mitochondrial genome of this fluke has not been known yet. Therefore, in the present study, we have determined the complete mt genome sequences of E. hortense and inferred its phylogenetic relationship with other digenean trematodes.

MATERIALS AND METHODS

Parasites and total genomic DNA isolation

Adult E. hortense worms were collected from the small intestine of a naturally infected dog in Daqing, Heilongjiang Province of China. The trematodes were washed in physiological saline, identified morphologically as E. hortense based on existing keys and descriptions [15], fixed in 70% (v/v) ethanol (Yixin Biological Technology Co., Shanghai, China), and stored at -20˚C until use. Total genomic DNA was extracted from individual fluke using a TIANamp Genomic DNA Kit (TIANGEN, Beijing, China) according to the manufacturer’s instructions, and DNA sample was stored at -20˚C until use. In order to independently verify the identity of the specimens, the internal transcribed spacer 2 (ITS2) was amplified from the extracted genomic DNA by PCR and sequenced according to the conventional method. The ITS2 sequences obtained were perfectly matched with that of E. hortense available in GenBank (U58101.1).

Amplification, sequencing, and assembling of mt DNA fragments

Amplification, sequencing, and assembly of mtDNA fragments were performed according to the methods previously described [12,16]. The 7 pairs of oligonucleotide primers were designed based on the conserved regions from published complete mtDNA sequences of Fasciola hepatica, Opisthorchis felineus, Paramphistomum cervi, and H. conoideum (Table 1). The cycling conditions were 94˚C for 5 min (initial denaturation); then 94˚C for 1 min (denaturation), 50˚C for 1 min (annealing), 72˚C for 1-3 min (extension) for 35 cycles, and a final extension at 72˚C for 7 min. Each PCR reaction yielded a single band, detected in a 1.0% (w/v) agarose gel stained with ethidium-bromide. PCR products were directly sequenced on an ABI 3370 DNA sequencer at Shanghai Sangon Biotech Company (Shanghai, China) using a primer walking strategy. The complete mtDNA sequences of E. hortense were assembled using DNAStar software as a sequence editor [17].

Sequences of primers used to amplify PCR fragments of mitochondrial genome from Echinostoma hortense

Sequence analysis of E. hortense mt genome

Gene annotation, genome organization, translation initiation, translation termination codons, and the boundaries between protein-coding genes of mtDNA were identified based on comparison with mt genomes of other trematodes reported previously [18]. Open reading frames and gene boundaries were confirmed by comparing with H. conoideum mt genome nucleotide sequences (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Translation initiation and translation termination codons were identified using genetic codon table for mitochondrion in MEGA 5 [19] and also based on comparison with the mt genomes of the trematodes reported previously [16,18]. The codon usage profiles of 12 protein-coding genes (PCGs) and their nucleotide composition were calculated using Geneious 6.1.5 program (Biomatters Co., Auckland, New Zealand) [20]. For the analyses of transfer RNA genes, putative secondary structures of 22 tRNA genes were identified using the program tRNAscan-SE (http://lowelab.ucsc.edu/tRNAscan-SE), or by visual identification combined with manual proofreading through anticodon and tRNA secondary structures of trematodes which are available in GenBank.

Phylogenetic analysis

To assess the phylogenetic relationship of E. hortense with other digenean trematodes, the complete mt genome sequences of 24 trematode species were retrieved from GenBank and employed for phylogenetic analysis. The mtDNA sequences were as follows: Clinostomum complanatum (KM923964.1), Calicophoron microbothrioides (KR337555.1), Clonorchis sinensis (JF729303), Dicrocoelium chinensis (NC_025279), Dicrocoelium dendriticum (NC_025280), Fasciola gigantica (KF543342), F. hepatica (NC_002546), Haplorchis taichui (KF214770), H. conoideum (KM111525), Metagonimus yokogawai (KC330755), Ogmocotyle sikae (KR006934.1), Opisthorchis felineus (EU921260), O. viverrini (JF739555), P. cervi (KF475773), Paramphistomum leydeni (KP341657.1), Paragonimus westermani (NC_002354) Schistosoma haematobium (DQ157222), S. japonicum (NC_002544), S. mansoni (NC_002545), S. mekongi (NC_002529), S. spindale (DQ157223), S. turkestanicum (HQ283100), Trichobilharzia regenti (NC_009680), and using Monogenea species Gyrodactylus thymalli (NC_009682) as the outgroup. The nucleotide alignments involved PCGs were generated on the basis of the protein alignment using codon alignment amino acid sequences for 12 PCGs, which were individually aligned utilizing Clustal X 1.83 under default parameters [21]. Phylogenetic analyses were performed with the maximum parsimony (MP) method. Phylogenetic reconstructions were carried out using PAUP* Version 4.0b10 [22]. Phylograms were drawn using the Tree View program version 1.65 [23].

RESULTS

Features of the mt genome of E. hortense

The circular complete mt genome of E. hortense (GenBank accession no. KR062182) was 14,994 bp in length (Fig. 1). The mt genome encoded 36 genes: 12 PCGs (cox1-3, nad1-6, nad4L, atp6, cytb), 22 transfer RNA genes, and 2 ribosomal RNA genes (rrnL and rrnS). All genes were transcribed in the same direction. The relative positions and lengths of each gene are given in Table 2. The nucleotide contents in the mt genome were 41.77% (T), 21.26% (A), 24.79% (G), and 12.18% (C), and the overall A+T content of the mt genome was 63.03%.

Fig. 1.

Arrangement of the mitochondrial genome for Echinostoma hortense. Gene scaling is approximate only. All genes have standard nomenclature, including the 22 tRNA genes, which are designated by the one-letter code for the corresponding amino acid, with numerals differentiating each of the 2 leucine and serine specifying tRNAs (L1 and L2 for codon families CUN and UUR, respectively; S1 and S2 for codon families AGC and UCA, respectively).

The organization of mitochondrial genome of Echinostoma hortense

A total of 3,349 amino acids were encoded by the E. hortense mt genome, and the length of PCGs was in the order: nad5>cox1>nad4>cytb>nad1>nad2>cox3>cox2>atp6>nad6>nad3>nad4L. The concatenated nucleotide sequences of 12 PCGs were 10,047 bp in length and composed of 45.13% T, 18.54% A, 24.73% G, and 11.60% C, with A+T accounting for 63.67% of the total nucleotides encoding the 12 PCGs. The initiation and termination codons of the above amino acid sequences were identified by sequence comparison with homologs in the mt genomes of other trematodes. The ATG codon was used in 8 PCGs (cox3, cytb, nad4, nad2, nad1, nad3, cox2, and nad5), and the GTG codon in 4r genes (nad4L, atp6, cox1, and nad5) as start codons. The TAG was used as stop codon in 5 genes (cytb, atp6, nad1, nad3, and cox2) and the TAA termination codon in the remaining 7 genes (cox13, nad4L, nad4, nad2, cox11, nad6, and nad5).

Total 22 tRNA genes, which ranged from 59 to 69 bp in length, were predicted from the mt genomes. Among the 22 tRNA genes, tRNA-SerAGC and tRNA-SerUCA have unpaired Darms which are replaced by the loops of 7-15 bp, but other 20 tRNA genes could be folded into the conventional cloverleaf structure (data not shown). The 2 ribosomal RNA genes were inferred, rrnL was located between tRNA-Thr and tRNA-Cys, and rrnS was located between tRNA-Cys and cox2. The rrnL and rrnS of E. hortense were 973 bp and 759 bp in length, respectively. The A+T contents of the rrnL and rrnS of E. hortense mt genome were 61.63% and 61.00%, respectively. Only 1 AT-rich non-coding region was inferred in the mt genome, and the AT-rich region located between nad5 and cox3, which is 1,553 bp long with A+T of 64.58%.

Phylogenetic analysis

Phylogenetic analysis of concatenated nucleotide sequence datasets for all 12 PCGs were performed using MP method, and the result showed that Opisthorchiidae, Heterophyidae, Paragonimidae, Dicrocoeliidae, Fasciolidae, Echinostomatidae, Paramphistomidae, Notocotylidae, and Clinostomidae formed 1 group, whereas Schistosomatidae formed another group (Fig. 2). In former group, besides the bird fluke Clinostomum complanatum, other trematodes gathered together and formed 1 clade. In this clade, Fasciolidae, Echinostomatidae, Paramphistomidae, Notocotylidae, and Clinostomidae trematodes belonged to order Echinostomida all formed monophyly. E. hortense and H. conoideum gathered together, and they were closer to each other than to the Fasciolidae and order Echinostomida trematodes with high nodal support (Fig. 2).

Fig. 2.

Phylogenetic relationship of Echinostoma hortense with other digenean trematodes based on mitochondrial genome sequence data. The concatenated amino acid sequences of 12 protein-coding genes were analyzed with maximum parsimony (MP) method, using Monogenean species Gyrodactylus thymalli (NC_009682) as the outgroup.

DISCUSSION

The complete mt genome of E. hortense (14,994 bp) is smaller than those of Eurytrema pancreaticum (15,031 bp), H. taichui (15,130 bp), M. yokogawai (15,258 bp), S. haematobium (15,003 bp), and S. spindale (16,901 bp), but slightly larger than those of other digenean species available in GenBank to date. The mt genome of E. hortense lacks atp8 gene, which is similar to the mt genomes of other trematodes [12,13,16,18]. All genes were transcribed in the same direction, which is consistent with the mt genomes of other digeneans [12,13,16,18,24]. The gene arrangement of 36 genes in E. hortense was the same as that of the H. conoideum (KM111525), P. cervi (KF475773), D. dendriticum (NC_025280), and D. chinensis (NC_025279), but different from that of other digenean species. Notably, there was a 28-64 bp long overlap between nad4L and nad4 in fluke mt genomes, but mostly was 28 bp or 40 bp in length. In E. hortense, nad4L and nad4 overlapped by 40 bp in size which is consistent with that of O. felineus, C. sinensis, F. hepatica, P. westermani, P. cervi, and H. taichui [13,16,18,24,25]. Though E. hortense and H. conoideum belong to the same family of Echinostomatidae, the lengthes of their cox3 genes were very different, with that of E. hortense shorter than H. conoideum by 312 bp.

The mt genome of E. hortense had 22 tRNA genes, like the majority of trematode mt genome sequences, except for that of P. westermani Korean isolate (NC_002354) and Indian isolate which have 23 and 24 tRNAs [24], respectively. The rrnL of E. hortense, at 973 bp, was the shortest among trematodes recorded yet, and the rrnS (759 bp) within the range of typical sizes for digenean mt genomes (700-800 bp). Usually, the size of non-coding region of trematode mt genome is between 55 bp and 2,500 bp, some of the trematode mt genomes have 2 non-coding regions (F. hepatica, F. gigantica, P. cervi, D. dendriticum, and D. chinensis), and a few flukes only contain 1 region (T. regenti, S. mekongi, H. conoideum, and H. taichui). Similarly, the mt genome of E. hortense only contains 1 non-coding region. In most trematode mt genomes, between genes or between tRNAs, there are many intergenic sequences with their lengths ranging usually from 1 bp to 50 bp, and the longest intergenic region in E. hortense mt genome reached 82 bp, but it was not AT-rich (45.12%) region.

There were many studies about phylogenetic status in the family Echinostomatidae have been done by some researchers. For example, Kudlai et al. [26] used 28S rDNA to study the phylogeny of 25 species of the superfamily Echinostomatoidea by Bayesian analysis. The results showed that 6 clades were clustered, and family Echinostomatidae was the largest group. Echinostoma and Echinoparyphium clustered together in a weakly-supported clade while the members of the other genera formed a 100% supported grouping. Echinostoma had a closer relationship with Echinoparyphium than to other genera of the family Echinostomatidae. In order to assess the relationships of Echinostoma with other closely related echinostomatids, 37 nad1 sequences and 15 ITS sequences of the genera Echinostoma, Echinoparyphium, Isthmiophora, and Hypoderaeum were analyzed by Kostadinova et al. [27]. The results showed that the genus Echinostoma is not a monophyletic group, and that E. hortense is most distantly related with other Echinostoma trematodes. This result was reconfirmed by Saijuntha et al. [28], who studied the phylogenetic relationships of Echinostoma and Hypoderaeum based on the cox1 sequences, and the results revealed that E. revolutum and E. malayanum of genus Echinostoma did not form a monophyletic clade and/or sister taxa. In contrast, a study of the phylogenetic relationships of North American echinostomes indicated that the genus Echinostoma is monophyletic, and the genera Hypoderaeum and Echinoparyphium are closely related as sister genera [29]. These contradictory results may be related to differences in geographical localities, sampled numbers, and the snail hosts of the echinostomes.

Therefore, Saijuntha et al. [28] suggested that the traditional morphological taxonomy of echinostomes, which is based on the size, shape, and arrangement of collar spines, the development of circumoral disc and also the testicular shape, should be reconsidered. The phylogenetic analysis in the present study indicated that the 2 fluke species, E. hortense and H. conoideum, of the family Echinostomatidae gathered together, which were closely related than to trematodes of the family Fasciolidae and other Echinostomida trematodes with high nodal support. This result was similar to the findings of previous reports. Although E. hortense and H. conoideum mt genomes were sequenced, more sequences of echinostomatid trematodes mt genomes are still needed to assess the phylogenetic relationships of these trematodes.

In conclusion, the present study determined the complete mt genome sequences of E. hortense, the first mt genome sequence of the genus Echinostoma of Echinostomatidae. The mtDNA dataset provided robust genetic evidence that E. hortense and H. conoideum were closer to each other than to the Fasciolidae and other Echinostomida trematodes, as well as provided new and useful genetic marker for further studies of the taxonomy, identification, and systematics of echinostomatid flukes.

Acknowledgements

This work was supported, in part, by the Fund for Imported Talents in Heilongjiang Bayi Agricultural University (XYB2014-07), and the Open Funds of the State Key Laboratory of Veterinary Etiological Biology, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences (grant no. SKLVEB2014KFKT006).

Notes

We have no conflict of interest related to this study.

References

1. Yamaguti S. Synopsis of digenetic trematodes of vertebrates Tokyo, Japan: Keigaku Publishing Co; 1971. p. 277–323.
2. Chai JY, Shin EH, Lee SH, Rim HJ. Foodborne intestinal flukes in Southeast Asia. Korean J Parasitol 2009;47(suppl):S69–S102.
3. Lee SK, Chung NS, Ko IH, Ko HI, Chai JY. Two cases of natural human infection by Echinostoma hortense. Korean J Parasitol 1986;24:77–81.
4. Asada J. On a new echinostomatid trematode and its life history. Trans Jpn Soc Pathol 1926;16:293–294.
5. Chai JY, Park JH, Jung BK, Guk SM, Kim JL, Shin EH, Klein TA, Kim HC, Chong ST, Baek LJ, Song JW. Echinostome infections in the striped-field mouse, Apodemus agrarius, and the Ussuri white-toothed shrew, Crocidura lasiura, caught near the demilitarized zone, Gyeonggi-do (Province), Republic of Korea. Korean J Parasitol 2009;47:311–314.
6. Jiang XL, Guan GJ, Yan JB. The significance of the Echinostoma hortense found in the pig in Sichuan. Agr Sci Rep 1985;2:82–84. (in Chinese).
7. Cho SY, Kang SY, Ryang YS. Helminthes infections in the small intestine of stray dogs in Ejungbu city, Kyunggi do, Korea. Korean J Parasitol 1981;19:55–59.
8. Chai JY, Bahk YY, Sohn WM. Trematodes recovered in the small intestine of stray cats in the Republic of Korea. Korean J Parasitol 2013;51:99–106.
9. Fan SQ, Sun MF. A case of Echinostoma hortense first found in human body in China and morphological observation of the worm. J Harbin Med Univ 1989;23:161–163. (in Chinese).
10. Arizono N, Uemoto K, Kondo K, Matsuno K, Yoshida Y, Maeda T, Yoshida H, Muto K, Inoue Z, Takahashi K. Studies on Echinostoma hortense Asada, 1926 with special reference to its human infection. Jpn J Parasitol 1976;1:36–45. (in Japanses).
11. Son WY, Huh S, Lee SU, Woo HC, Hong SJ. Intestinal trematode infections in the villagers in Koje-myon, Kochang-gun, Kyongsangnam-do, Korea. Korean J Parasitol 1994;32:149–155.
12. Wang Y, Wang CR, Zhao GH, Gao JF, Li MW, Zhu XQ. The complete mitochondrial genome of Orientobilharzia turkestanicum supports its affinity with African Schistosoma spp. Infect Genet Evol 2011;11:1964–1970.
13. Lee D, Choe S, Park H, Jeon HK, Chai JY, Sohn WM, Yong TS, Min DY, Rim HJ, Eom KS. Complete mitochondrial genome of Haplorchis taichui and comparative analysis with other trematodes. Korean J Parasitol 2013;51:719–726.
14. Cribb TH, Bray RA, Littlewood DTJ, Pichelin SP, Herniou EA. The Digenea. In : Littlewood DTJ, Bray RA, eds. Interrelationships of the Platyhelminthes London, UK: Taylor and Francis; 2001. p. 168–185.
15. Cho CM, Tak WY, Kweon YO, Kim SK, Choi YH, Kong HH, Chung DI. A human case of Echinostoma hortense (Trematoda: Echinostomatidae) infection diagnosed by gastroduodenal endoscopy in Korea. Korean J Parasitol 2003;41:117–120.
16. Le TH, Blair D, McManus DP. Complete DNA sequence and gene organization of the mitochondrial genome of the liverfluke, Fasciola hepatica L. (Platyhelminthes: Trematoda). Parasitology 2001;123:609–621.
17. Burland TG. DNASTAR's Lasergene sequence analysis software. Methods Mol Biol 2000;132:71–91.
18. Shekhovtsov SV, Katokhin AV, Kolchanov NA, Mordvinov VA. The complete mitochondrial genomes of the liver flukes Opisthorchis felineus and Clonorchis sinensis (Trematoda). Parasitol Int 2010;59:100–103.
19. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 2011;28:2731–2739.
20. Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper A, Markowitz S, Duran C, Thierer T, Ashton B, Meintjes P, Drummond A. Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 2012;28:1647–1649.
21. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 1997;25:4876–4882.
22. Swofford DL. PAUP*. Phylogenetic analysis using parsimony (and other methods). Version 4.0b10 Sunderland MA: Sinauer Associates; 2003.
23. Page RD. TreeView: an application to display phylogenetic trees on personal computers. Comput Appl Biosci 1996;12:357–358.
24. Biswal DK, Chatterjee A, Bhattacharya A, Tandon V. The mitochondrial genome of Paragonimus westermani (Kerbert, 1878), the Indian isolate of the lung fluke representative of the family Paragonimidae (Trematoda). Peer J 2014;2:e484.
25. Yan HB, Wang XY, Lou ZZ, Li L, Blair D, Yin H, Cai JZ, Dai XL, Lei MT, Zhu XQ, Cai XP, Jia WZ. The mitochondrial genome of Paramphistomum cervi (Digenea), the first representative for the family Paramphistomidae. PLoS One 2013;8:e71300.
26. Kudlai O, Tkach VV, Pulis EE, Kostadinova A. Redescription and phylogenetic relationships of Euparyphium capitaneum Dietz, 1909, the type-species of Euparyphium Dietz, 1909 (Digenea: Echinostomatidae). Syst Parasitol 2015;90:53–65.
27. Kostadinova A, Herniou EA, Barrett J, Littlewood DT. Phylogenetic relationships of Echinostoma Rudolphi, 1809 (Digenea: Echinostomatidae) and related genera re-assessed via DNA and morphological analyses. Syst Parasitol 2003;54:159–176.
28. Saijuntha W, Sithithaworn P, Duenngai K, Kiatsopit N, Andrews RH, Petney TN. Genetic variation and relationships of four species of medically important echinostomes (Trematoda: Echinostomatidae) in South-East Asia. Infect Genet Evol 2011;11:375–381.
29. Detwiler JT, Bos DH, Minchella DJ. Revealing the secret lives of cryptic species: examining the phylogenetic relationships of echinostome parasites in North America. Mol Phylogenet Evol 2010;55:611–620.

Article information Continued

Fig. 1.

Arrangement of the mitochondrial genome for Echinostoma hortense. Gene scaling is approximate only. All genes have standard nomenclature, including the 22 tRNA genes, which are designated by the one-letter code for the corresponding amino acid, with numerals differentiating each of the 2 leucine and serine specifying tRNAs (L1 and L2 for codon families CUN and UUR, respectively; S1 and S2 for codon families AGC and UCA, respectively).

Fig. 2.

Phylogenetic relationship of Echinostoma hortense with other digenean trematodes based on mitochondrial genome sequence data. The concatenated amino acid sequences of 12 protein-coding genes were analyzed with maximum parsimony (MP) method, using Monogenean species Gyrodactylus thymalli (NC_009682) as the outgroup.

Table 1.

Sequences of primers used to amplify PCR fragments of mitochondrial genome from Echinostoma hortense

Primer name Sequence of primer (5ʹ-3ʹ) Size (kb)
EH-1 F: AATATGCAAACACACCCGACTG ~3.8
R: CGATGTTGCGTTCTGTAGAGTCTAAGG
EH-2 F: GCCTCCTGTGTTTGTCTCTCGCTTTA ~2.2
R: CTCGCACCATATCCCAATTAGCC
EH-3 F: GGTTTATTACAGAGGTTT ~2.5
R: ATAACCATAGTAACAGAA
EH-4 F: TCTTGTTCTTGCTATGTTGGCTATT ~2.3
R: TTTAGCGGACCATCTCTTACAC
EH-5 F: AGCCAGGTCGGTTCTTATC ~1.4
R: ACCACACAACTCCGTACAATAAC
EH-6 F: CGTTAGGGTGTGTCCAACTGT ~1.7
R: AGCAACAATCTTCTTTAAGTCCATA
EH-7 F: GTGGGAGTATTTAGGTCTTGTCAGG ~4.7
R: GAACACCACTAGAATAAGGAATTAC

Table 2.

The organization of mitochondrial genome of Echinostoma hortense

Gene/Region Positions
No. of
Codons
Start (5') End (3') Nucleotides Aminoacids Initiation Termination
cox3 1 630 630 209 ATG TAA
tRNA-His 652 716 65
cytb 718 1,791 1,074 357 ATG TAG
nad4L 1,802 2,089 288 95 GTG TAA
nad4 2,050 3,297 1,248 415 ATG TAA
tRNA-Gln 3,342 3,403 62
tRNA-Phe 3,408 3,471 64
tRNA-Met 3,475 3,539 65
atp6 3,540 4,055 516 171 GTG TAG
nad2 4,066 4,935 870 289 ATG TAA
tRNA-Val 4,939 5,001 63
tRNA-Ala 5,032 5,096 65
tRNA-Asp 5,100 5,162 63
nad1 5,158 6,057 900 299 ATG TAG
tRNA-Asn 6,063 6,129 67
tRNA-Pro 6,134 6,196 63
tRNA-Ile 6,200 6,261 62
tRNA-Lys 6,267 6,332 66
nad3 6,340 6,696 357 118 ATG TAG
tRNA-SerAGC 6,704 6,762 59
tRNA-Trp 6,771 6,838 68
cox1 6,842 8,383 1,542 513 GTG TAA
tRNA-Thr 8,409 8,473 65
rrnL 8,474 9,446 973
tRNA-Cys 9,447 9,506 60
rrnS 9,507 10,265 759
cox2 10,266 10,865 600 199 ATG TAG
nad6 10,948 11,397 450 149 ATG TAA
tRNA-Tyr 11,399 11,462 64
tRNA-LeuCUA 11,463 11,525 63
tRNA-SerUCA 11,526 11,587 62
tRNA-LeuUUA 11,593 11,656 64
tRNA-Arg 11,655 11,719 65
nad5 11,722 13,293 1,572 523 GTG TAA
tRNA-Gly 13,304 13,370 67
tRNA-Glu 13,373 13,441 69
NC (64.58%) 13,442 14,994 1,553