INTRODUCTION
Human filariasis is caused by members of the Filaridae family, including species of Dirofilaria, Brugia, Wuchereria, Onchocerca, Dipetalonema, Loa, and Meningonema; it is transmitted to humans by various kinds of insect vectors [1]. Dirofilariasis is typically a disease of animals, which can also be easily transmitted to humans by mosquitoes of the genera Anopheles, Culex, and Aedes [2]. All of these mosquitoes are found in Vietnam. Of the 30 different species of Dirofilaria, D. repens and D. immitis are the 2 most common species that frequently infect humans [3]. Other Dirofilaria species have also been reported to infect Vietnamese carnivore species [4].
There have been over 1,000 cases of dirofilariasis, reported throughout the world, including 300 cases involving the lungs or viscera and over 800 cases involving the subcutaneous tissues or eyes [1]. Most of these were caused by D. immitis or D. repens. D. immitis is a parasite of dogs and cats and it can occasionally become a causative agent of lung and subcutaneous dirofilariasis in humans. D. repens can also infect humans and is associated with diseases of various organs, including the conjunctiva, lungs, soft tissues (including the breast), brain, liver, intestine, lymphatic glands, and muscles [5,6].
In some cases, identification of Dirofilaria spp. based only on the morphology is difficult. Therefor, the use of molecular methods, such as PCR, is necessary for effective species identification [7]. Nuclear and mitochondrial genes are useful for the identification of helminth species, and especially the latter genes have been frequently used for identification of Dirofilaria spp. [8-10].
Given that there has been an increasing number of patients suffering from D. repens infection, further research is required on this newly emerging zoonotic disease as a public health threat in Vietnam. Accurate diagnosis, proper identification, and control measures are therefore needed to control human dirofilariasis in Vietnam.
CASE RECORD
During 2006 to 2010, a total of 9 patients with a swelling mass under their conjunctiva admitted to the National Eye Hospital (NEH), and a patient with a swelling in the subcutaneous tissue admitted to the Military Hospital 108. By surgery, live parasites were collected from these patients and species identification was tried. The total 10 patients, 27-77 years old, were from 4 provinces in the North Vietnam, including Hanoi City (4 patients), Ninh Binh province (3 patients), Ha Nam province (2 patients), and Hung Yen province (1 patient) (Table 1). Nine of them had similar symptoms, such as a painful, itchy, swollen, and tangible nodule in the eye; 6 cases involved the right eye and 3 involved the left. Another patient, 36-year-old, had a tumor (3×4 cm) in the left subcutaneous tissue, which appeared as a red nodule and was itchy. Surgical biopsies were performed on all patients and living parasites were recovered from each patient.
Parasites measured 4.0-12.5 cm in length and 0.5-0.6 mm in width. The worms were identified by the morphology, and pictures were taken (Fig. 1). Among the worms, 3 were chosen (2 from the conjunctiva and 1 from the subcutaneous tissue), marked as GCA-VN1, GCH-VN2, and GCD-VN3, respectively, and analyzed by molecular methods.
Identification of species
Parasites recovered from the conjunctiva of the eye and subcutaneous tissue were identified as D. repens on the basis of the morphological keys by Miyazaki in 1991 [11]. Molecular characterization was conducted as follows: genomic DNA was extracted from individual parasites using a Qiagen genomic DNA extraction Kit (Qiagen, Valencia, California, USA). Extracted genomic DNA was diluted to a working concentration of 100 ng/µl, and 1 µl of this was used in 50 µl PCR reaction volume. PCR amplified a fragment of the cytochrome c oxidase subunit 1 (cox1), using the UCO1F1-UCO1R2 primer pairs and additionally as previously described as follows [9,12]: UCO1F1: 5'GGTGTTGGTTGAACTTTTTATCCTCC3' and UCO1R2: 5'CCAACCATAAACATATGATGAGCCCA3'.
PCR products purified using a QIAquick Purification Kit (Qiagen) were subjected to direct sequencing using the Big-Dye Terminator Cycle Sequencing technology on an automated sequencer, ABI 3100 Avant Genetic Analyzer (Applied Biosystems, Foster City, California, USA). Sequences were then edited using SeqEdv1.03, aligned using Assembly LIGNv1.9c, and analyzed using the MacVector 8.2 package (Accelrys Inc., San Diego, California, USA). Sequences were searched against the GenBank database, using the NCBI BLAST program (http://www.ncbi.nlm.nih.gov/blast/Blast.cgi), and approximately 500 bp of the cox1 of D. repens from Italy and others sequences were used for comparative purposes. The cox1 sequences of the Vietnamese Dirofilaria, including parasites from the conjunctiva (GCA-VN1 and GCH-VN2) and subcutaneous tissue (GCD-VN3), were compared with D. repens from Italy (ITA1 and ITA2), D. immitis from Australia (Dimm), Brugia malayi (Bmal), and Onchocerca volvulus (Ovol), using GENEDOC2.5 and MEGA3.1 (Table 2).
PCR products (500 bp of cox1) were successfully sequenced, using UCO1F1 and UCO1R2 primers. A portion of cox1 from the Vietnamese Dirofilaria
cox1, including 461 nucleotides (A) and 153 amino acids (B), were compared with the cox1 from Italian D. repens (Drep [ITA1] and Drep [ITA2], Australian D. immitis [Dimm], B. malayi [Bmal], and O. volvulus [Ovol]) (Table 3; Fig. 2).
The 3 portions of the cox1 sequences of the Vietnamese Dirofilaria exhibited a 95% nucleotide and 99-100% amino acid identity with the Italian D. repens (GenBank no. AJ271614 and DQ358814). In contrast, these sequences exhibited a 89% nucleotide and 96% amino acid identity with the Australian D. immitis; 87% (nucleotide) and 94% (amino acid) similarity with B. malayi (AF538716); and 91% (nucleotide) and 98% (amino acid) similarity with O. volvulus (AF015193) (Table 3; Fig. 2). The phylogenetic analysis results are shown in Fig. 3. Consequently, we characterized the species of filaria samples from the eye and subcutaneous tissue of patients in Vietnam as D. repens (Nematoda: Filarioidea).
DISCUSSION
In this study, 10 Dirofilaria worm specimens from humans, including 9 from the conjunctiva and 1 from the subcutaneous tissue, were identified by the morphology and molecular methods as D. repens. In Vietnam, the filarial worm of this species was first reported from a human conjunctiva in 2008 [12], and another was reported from the human subcutaneous tissue in 2010 [13]. This is the 3rd report of human D. repens infection in Vietnam which involved the conjunctiva or subcutaneous tissue.
This species is parasitic in dogs, cats, and wild animals [1], and together with D. immitis it can cause complicated epidemiology in zoonotic diseases. Dirofilariasis is transmitted to humans by mosquitoes, including Anopheles, Culex, and Aedes [2], and these mosquitoes are common in Vietnam. Feeding dogs and cats are very common in the whole country. Thus, a high risk for human dirofiliasis is existing everywhere in Vietnam.
