Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Original Article

Experimental Murine Fascioliasis Derives Early Immune Suppression with Increased Levels of TGF-β and IL-4

The Korean Journal of Parasitology 2012;50(4):301-308.
Published online: November 26, 2012

1Tissue Research Program, Laboratory of Pathology, Center for Cancer Research, National Cancer Institute, NIH, Bethesda, Maryland, USA.

2Department of Molecular Parasitology, Sungkyunkwan University School of Medicine and Centers for Molecular Medicine, Samsung Biomedical Research Institute, Suwon 440-746, Korea.

3Department of Parasitology, Ewha Womans University School of Medicine, Seoul 158-710, Korea.

Corresponding author (kongy@skku.edu)

†Present affiliation: Department of Microbiology, Graduate School of Medicine, Gachon University of Medicine and Science, Incheon 406-799, Korea.

• Received: March 29, 2012   • Revised: June 13, 2012   • Accepted: July 5, 2012

© 2012, Korean Society for Parasitology and Tropical Medicine

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 10,261 Views
  • 68 Download
  • 10 Crossref
  • 12 Scopus
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Evaluation of Th1/Th2, regulatory cytokines and transcriptional factor FoxP3 in sheep immunized with a partially protective and non-protective vaccine and challenged with Fasciola hepatica
    María Teresa Ruiz-Campillo, Isabel Lourdes Pacheco, Nieves Abril, María José Bautista, Álvaro Martínez-Moreno, Francisco Javier Martínez-Moreno, Leandro Buffoni, José Pérez, Verónica Molina-Hernández, Rafael Zafra
    Veterinary Research.2024;[Epub]     CrossRef
  • Fascioliasis: Image Findings, Diagnosis, and Treatment
    Jae Seung Lee
    Clinical Ultrasound.2024; 9(1): 18.     CrossRef
  • Fasciolosis: pathogenesis, host-parasite interactions, and implication in vaccine development
    Luis Miguel Flores-Velázquez, María Teresa Ruiz-Campillo, Guillem Herrera-Torres, Álvaro Martínez-Moreno, Francisco Javier Martínez-Moreno, Rafael Zafra, Leandro Buffoni, Pablo José Rufino-Moya, Verónica Molina-Hernández, José Pérez
    Frontiers in Veterinary Science.2023;[Epub]     CrossRef
  • The immunosuppression effects of deforolimus (ridaforolimus, AP23573) on allograft organ transplantation
    Lumin Wang, Yanping Li, Dawei Yang, Jiazhao Fu, Bin Zhao, Yaguang Li, Yanrong Ye, Zhongquan Qi
    Clinical and Translational Discovery.2023;[Epub]     CrossRef
  • Immunization of Goats with Recombinant Protein 14-3-3 Isoform 2(rHcftt-2) Induced Moderate Protection against Haemonchus contortus Challenge
    Yongqian Bu, Caiwen Jia, Xiaowei Tian, Kalibixiati Aimulajiang, Muhammad Ali Memon, Ruofeng Yan, Xiaokai Song, Lixin Xu, Xiangrui Li
    Pathogens.2020; 9(1): 46.     CrossRef
  • Characterization of dendritic cells and follicular dendritic cells in the hepatic lymph nodes and liver of sheep experimentally infected with Fasciola hepatica
    María Teresa Ruiz-Campillo, Verónica Molina-Hernández, María José Bautista, Isabel L. Pacheco, Rafael Zafra, Leandro Buffoni, Francisco Javier Martínez-Moreno, Alvaro Martínez-Moreno, José Pérez
    Veterinary Research.2020;[Epub]     CrossRef
  • Helminth infection-induced carcinogenesis: spectrometric insights from the liver flukes, Opisthorchis and Fasciola
    Maria João Gouveia, Maria Y. Pakharukova, Gabriel Rinaldi, Viatcheslav A. Mordvinov, Paul J. Brindley, Fátima Gärtner, Nuno Vale, Martin Michaelis
    Experimental Results.2020;[Epub]     CrossRef
  • Fasciola and fasciolosis in ruminants in Europe: Identifying research needs
    N. J. Beesley, C. Caminade, J. Charlier, R. J. Flynn, J. E. Hodgkinson, A. Martinez-Moreno, M. Martinez-Valladares, J. Perez, L. Rinaldi, D. J. L. Williams
    Transboundary and Emerging Diseases.2018; 65: 199.     CrossRef
  • Fasciola hepatica induces Foxp3 T cell, proinflammatory and regulatory cytokine overexpression in liver from infected sheep during early stages of infection
    Isabel L. Pacheco, Nieves Abril, Rafael Zafra, Verónica Molina-Hernández, Noelia Morales-Prieto, María J. Bautista, María T. Ruiz-Campillo, Raúl Pérez-Caballero, Alvaro Martínez-Moreno, José Pérez
    Veterinary Research.2018;[Epub]     CrossRef
  • Association of Fasciola hepatica Infection with Liver Fibrosis, Cirrhosis, and Cancer: A Systematic Review
    Claudia Machicado, Jorge D. Machicado, Vicente Maco, Angelica Terashima, Luis A. Marcos, Hector H Garcia
    PLOS Neglected Tropical Diseases.2016; 10(9): e0004962.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Experimental Murine Fascioliasis Derives Early Immune Suppression with Increased Levels of TGF-β and IL-4
Korean J Parasitol. 2012;50(4):301-308.   Published online November 26, 2012
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Experimental Murine Fascioliasis Derives Early Immune Suppression with Increased Levels of TGF-β and IL-4
Korean J Parasitol. 2012;50(4):301-308.   Published online November 26, 2012
Close

Figure

  • 0
  • 1
  • 2
  • 3
  • 4
Experimental Murine Fascioliasis Derives Early Immune Suppression with Increased Levels of TGF-β and IL-4
Image Image Image Image Image
Fig. 1 Changes of total splenocytes, and T- and B-cell populations in mice infected with 5 metacercariae of F. hepatica. (A) Chronological changes of splenocytes in 3 different mouse strains. The experiment was independently quadruplicated. Open and closed symbols each represent control and infection groups. aP<0.05 and bP<0.01. (B) Changes of the relative proportions of B- and T-cells. Splenocytes were harvested, washed, immunostained with FITC-conjugated anti-CD3 and PE-anti-CD19 antibodies, and were analyzed by FACS caliber. The proportions of CD3+ and CD19+ cells in the splenocytes were standardized on the basis of age-matched normal control mice. Mean±SEM (n=5). (C) Changes of splenic CD4+ and CD8+ T cell populations. Splenocytes were obtained from normal and infected mice and were doubly stained with FITC-conjugated anti-CD3+ and PE-conjugated anti-CD4+ or CD8+ antibodies. Changes of T cell populations were analyzed by flow cytometry. Mean±SEM (n=5).
Fig. 2 Expression of cytokine mRNA transcripts in total spleen cells of BALB/c, C57BL/6, and C3H/He mice infected with F. hepatica by competitive RT-PCR. (A) Construction and quantification of IL-4 competitor molecule as an internal standard (IS) during competitive RT-PCR. The cDNA synthesized from mouse spleen cells was added to various concentrations of the competitor prior to PCR amplification. The PCR products were resolved by 8% polyacrylamide gel, visualized by ethidium bromide staining, and were quantified by a use of densitometer. After densitometry, the following calculations were performed to determine the molecules/µl of the IL-4 that was 346 bp: [(µg/µl)/(330 µg/µmol/bp×bp IS)]×6.02×1017 molecules/µmol. We approximated that 330×bp equals the molecular weight of internal standard. Expression levels of mRNA transcripts of IL-4 (B), TNF-α (C), and IL-1β (D) in BALB/c, C57BL6, and C3He mice infected with F. hepatica. Total RNAs were isolated from the spleen cells and were quantified by quantitative competitive RT-PCR. The data represent the mean±SEM of 3 independent experiments. aP<0.05 and bP<0.01.
Fig. 3 Splenomegaly index of Fasciola hepatica-infected mice. Index of splenomegaly was calculated as (spleen weight/body weight)×10-4 [30]. The data represent the mean±SEM of 5 mice per each group. aP<0.05 and bP<0.01.
Fig. 4 Change of Mac1+ cell population in mice infected with F. hepatica. The total splenocytes were obtained from the mice and were immunostained with FITC-conjugated anti-Mac1 antibody. The immunostained cells were analyzed by flow cytometry. The data represent the mean±SEM from 3 independent experiments. aP<0.05 and bP<0.01.
Fig. 5 Concentrations of serum TGF-β at weeks 1, 2, and 3 after F. hepatica infection. The amount of TGF-β was determined in sera of BALB/c, C57BL/6, and CH3/He mice at the indicated time intervals. The latent TGF-β was activated by adding 6 N HCl for 30 min after which was neutralized with 6 N NaOH in 0.5 M HEPES buffer. The samples were subjected to serial dilution in 0.1% BSA-PBS and incubated with anti-TGF-β mouse monoclonal antibodies. Anti-TGF-β chicken polyclonal antibody was used as the detection antibody and the reactions were developed by tetramethylbenzidine. The colorimetric reaction was stopped with 1 N H2SO4. The absorbance was read at 450 nm. The blank values were subtracted from each experimental group, including the standard and sample. The data represent the mean±SEM from 3 independent experiments. aP<0.05 and bP<0.01.
Experimental Murine Fascioliasis Derives Early Immune Suppression with Increased Levels of TGF-β and IL-4
Primers Nucleotide sequence (5´ → 3´)a Product size in bp (Intact mRNA/ISb) Tm (˚C) IL-4 F: AACGAGGTCACAGGAGAAG 228/346 60 R: GTCTATCGATGAATCCAGGC IL-1β F: TGCAGAGTTCCTACATGGTCAACCC 386/329 62 R: GTGCTGCCTAATGTCCCCTTGAATC TNF-α F: ACTAGTGGTGCCAGCCGATGGGTTG 370/324 62 R: GTGGGGGCTGGGTAGAGAATGGATG
Table 1. Cytokine primers and optimum conditions for quantitative competitive RT-PCR

F and R mean sense primer and antisense primer, respectively.

IS, internal standard molecules for quantitation of mRNA expression level.