Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Original Article

Identification and Molecular Characterization of Parkin in Clonorchis sinensis

The Korean Journal of Parasitology 2015;53(1):65-75.
Published online: February 27, 2015

Department of Medical Environmental Biology, Chung-Ang University College of Medicine, Seoul 156-756, Korea

*Corresponding author (hongsj@cau.ac.kr)

Xuelian Bai, and Tae Im Kim contributed equally to this work.

• Received: July 28, 2014   • Revised: November 18, 2014   • Accepted: December 6, 2014

© 2015, Korean Society for Parasitology and Tropical Medicine

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 15,123 Views
  • 99 Download
  • 3 Web of Science
  • 2 Crossref
  • 3 Scopus
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Characterization of a novel organic solute transporter homologue from Clonorchis sinensis
    Yanyan Lu, Won Gi Yoo, Fuhong Dai, Ji-Yun Lee, Jhang Ho Pak, Woon-Mok Sohn, Sung-Jong Hong, John Pius Dalton
    PLOS Neglected Tropical Diseases.2018; 12(4): e0006459.     CrossRef
  • Molecular and structural characteristics of multidrug resistance-associated protein 7 in Chinese liver fluke Clonorchis sinensis
    Fuhong Dai, Won Gi Yoo, Ji-Yun Lee, Yanyan Lu, Jhang Ho Pak, Woon-Mok Sohn, Sung-Jong Hong
    Parasitology Research.2017; 116(3): 953.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Identification and Molecular Characterization of Parkin in Clonorchis sinensis
Korean J Parasitol. 2015;53(1):65-75.   Published online February 27, 2015
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Identification and Molecular Characterization of Parkin in Clonorchis sinensis
Korean J Parasitol. 2015;53(1):65-75.   Published online February 27, 2015
Close

Figure

  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
Identification and Molecular Characterization of Parkin in Clonorchis sinensis
Image Image Image Image Image Image Image
Fig. 1. Multiple alignment of CsParkin with parkins of other animals. Conservation of amino acid residues are displayed with different background darkness; high in black and moderate in gray. An ubiquitin-like domain (Ubl) in N-terminus is boxed. RING domains are boxed and labeled with serial number. An in-between-RING domain (IBR) is boxed. The cysteine and histidine residues bind Zn2+ ions are indicated with triangles (▲). A diamond (◆) indicates RING1-binding residue in the Ubl domain. An open circle (○) denotes E2-binding site in RING1 domain. A closed circle (●) indicates a catalytic residue in RING2 domain. Aligned are parkin of Homo sapiens (BAA25751.1), Rattus norvegicus (AAG37013.1), Mus musculus (AAG13890.1), Sus scrofa (NP_001038068.1), Danio rerio (NP_001017635.1), Takifugu rubripes (AAS79348.1), Drosophila melanogaster (AAM43930.1), and Caenorhabditis elegans (CAB04599.2). Identity of each parkin protein to CsParkin is given at the end of the sequence.
Fig. 2. A putative tertiary structure of CsParkin. The tertiary structure of CsParkin was predicted with Phyre2 using rat parkin as a template. Conformations of Ubl, RING0, RING1, IBR, and RING2 domain are displayed in different colors. A grey sphere denotes the bound Zn2+ ion. An E2-binding region in RING1 domain is marked by a broken purple circle. REP fragment containing a key residue Trp339 is identified between IBR and RING2. The catalytic residue Cys375 is depicted with a yellow sphere.
Fig. 3. A phylogenetic tree of CsParkin with homolog of other animals. Number at each node denotes bootstrap value (in percentage) generated using by Neighbor-Joining method (1,000 replicates). Parkin is labeled each with its species name. A phylogenetic tree was drawn with 24 parkin homologs of vertebrate and invertebrate animals retrieved from GenBank using MEGA5.0.
Fig. 4. Immunoblotting of partial recombinant and native CsParkins. The partial recombinant CsParkin protein and the C. sinensis adult extract were resolved by 10% SDS-PAGE and transferred onto a nitrocellulose membrane. Blots were probed with a mouse anti-partial recombinant CsParkin immune serum. Lane 1, partial recombinant CsParkin; Lane 2, native CsParkin from soluble extract of adult C. sinensis. M, molecular mass.
Fig. 5. Relative transcriptional level of CsParkin in the developmental stages of C. sinensis. Quantitative RT-PCR was performed on total cDNA of the C. sinensis adults and metacercariae. cDNAs of β-actin, calcyphosine and phosphoglycerate kinase were employed as references to calculate relative transcription of the target gene using 2-ΔΔCt equation.
Fig. 6. In vitro ubiquitination assay on recombinant CsParkin. Full-length recombinant CsParkin was assayed in vitro for ubiquitination activity. Human parkin was employed as a positive control. Panel A, a control reaction set was run with human parkin. Panel B, the reaction set was run with recombinant full-length CsParkin. After incubation, reactions were deployed by 10% SDS-PAGE, transferred onto a nitrocellulose membrane, and probed with mouse anti-human ubiquitin IgG. An arrow indicates an ubiquitinated CsParkin.
Fig. 7. Localization of CsParkin in the C. sinensis adults and metacercariae. Panels A and D, sperms (Sp) in seminal receptacle. Panels B and E, oral sucker (OS); Panels C and F, testis (Ts) and mesenchymal tissue (Ms); Panels G and H, metacercariae. Panels A, B, C, and G were probed with mouse anti-CsParkin immune sera, and Panels D, E, F, and H with normal mouse sera. For technical information, refer to the Materials and Methods.
Identification and Molecular Characterization of Parkin in Clonorchis sinensis
Target Forward primer Reverse primer
CsParkin CACTTCCTCAACGCCATTA TATCCAGCACCAATCAGTAGA
β-Actin CGCTACGATCTTGATCTTCAT AGTTTCCTTGGTATGGAGTCT
Calcyphosine AATCCGAAATACCAGAACAA TGAACGCTTGACGAATCAT
Phosphoglycerate kinase GCGGGTGCTTATGCGAGTTGA CACCGGGTTGAGGGAATATCT
Table 1. Primer sequences of target and reference cDNAs used in quantitative real-time PCR