Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Brief Communication

Monitoring of Fasciola Species Contamination in Water Dropwort by COX1 Mitochondrial and ITS-2 rDNA Sequencing Analysis

The Korean Journal of Parasitology 2015;53(5):641-645.
Published online: October 29, 2015

1Department of Infection Biology, Chungnam National University School of Medicine, Daejeon 35015, Korea

2Microbial Safety Team, National Institute of Agricultural Science, Rural Development Administration, Wanju 55365, Korea

3Department of Gastroenterology, The Affiliated Hospital of Guangdong Medical College, Zhanjiang 524-001, Guangdong, China

* Corresponding author (yhalee@cnu.ac.kr)

In-Wook Choi and Hwang-Yong Kim contributed equally to this work.

• Received: August 18, 2015   • Revised: September 25, 2015   • Accepted: September 25, 2015

© 2015, Korean Society for Parasitology and Tropical Medicine

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 10,012 Views
  • 107 Download
  • 8 Web of Science
  • 7 Crossref
  • 9 Scopus
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Isolation and molecular identification of liver fluke cercariae in freshwater snails of Chaharmahal and Bakhtiari province, Iran
    Bijan Hosseinpour Aghaei, Nadia Taiefi Nasrabadi, Yaser Pirali Kheirabadi, Seyed Shapoor Reza Shojaei
    Molluscan Research.2024; 44(1): 84.     CrossRef
  • Morphological and molecular identification of lymnaeid snail and trematodes cercariae in different water bodies in Perak, Malaysia
    Nazir Ahmad Tookhy, Nur Mahiza Md Isa, Rozaihan Mansor, Yasmin Abd Rahaman, Nur Indah Ahmad, Dung Thi Bui, Lokman Hakim Idris, Noor Hazfalinda Hamzah, Norhadila Zulkifli
    Parasitology Research.2023; 122(7): 1475.     CrossRef
  • Green vegetable juice as a potential source of human fascioliasis in Korea
    Sungim Choi, Sunghee Park, Sooji Hong, Hyejoo Shin, Bong-Kwang Jung, Min Jae Kim
    One Health.2022; 15: 100441.     CrossRef
  • Phylogenetic Characteristics of Fasciola hepatica Isolated from a Korean Patient
    Mi Jin Jeong, Jae Kyun Park, Hak Sun Yu
    The Korean Journal of Parasitology.2022; 60(5): 367.     CrossRef
  • A Descriptive Study of Human Fascioliasis in Qaemshahr, Mazandaran Province, Iran: Its Prevalence and Risk Factors
    Lotfollah Davoodi, Azadeh Mizani, Roya Najafi-Vosough, Saeed Hosseini Teshnizi, afsane amouei, Mousa Motavallihaghi, Hamideh Izadyar, Fateme Amuei, Sara Pourhaghighi, Seyed Reza Mirbadie, Eissa Soleymani
    Archives of Clinical Infectious Diseases.2022;[Epub]     CrossRef
  • A Review ofOenanthe javanica(Blume) DC. as Traditional Medicinal Plant and Its Therapeutic Potential
    Chuan-li Lu, Xiu-fen Li
    Evidence-Based Complementary and Alternative Medicine.2019; 2019: 1.     CrossRef
  • Human fascioliasis infection sources, their diversity, incidence factors, analytical methods and prevention measures
    S. Mas-Coma, M. D. Bargues, M. A. Valero
    Parasitology.2018; 145(13): 1665.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Monitoring of Fasciola Species Contamination in Water Dropwort by COX1 Mitochondrial and ITS-2 rDNA Sequencing Analysis
Korean J Parasitol. 2015;53(5):641-645.   Published online October 29, 2015
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Monitoring of Fasciola Species Contamination in Water Dropwort by COX1 Mitochondrial and ITS-2 rDNA Sequencing Analysis
Korean J Parasitol. 2015;53(5):641-645.   Published online October 29, 2015
Close

Figure

  • 0
  • 1
  • 2
  • 3
Monitoring of Fasciola Species Contamination in Water Dropwort by COX1 Mitochondrial and ITS-2 rDNA Sequencing Analysis
Image Image Image Image
Fig. 1. Agarose gel electrophoresis of PCR products containing the mitochondrial cytochrome c oxidase subunit 1 (cox1) marker of Fasciola hepatica. M, 100 bp marker; lane 1, positive control (adult F. hepatica worm); lanes 2-7, F. hepatica negative samples of water dropwort; lane 8; No. 11 F. hepatica positive sample of water dropwort, lane 9; No. 18 F. hepatica positive sample of water dropwort.
Fig. 2. Agarose gel electrophoresis of PCR products containing the nuclear ribosomal internal transcribed spacer 2 (ITS-2) marker of F. hepatica. M, 100 bp marker; lane 1, positive control (adult F. hepatica worm); lanes 2-7, F. hepatica negative samples of water dropwort; lane 8; No. 11 F. hepatica positive sample of water dropwort, lane 9; No. 18 F. hepatica positive sample of water dropwort.
Fig. 3. F. hepatica cox1 nucleotide sequences of 2 positive samples obtained from PCR products compared with a GenBank sequence (accession no. GU112476.1). Base homologies are indicated by a dot (·); base changes are shown in orange. Fh COX1 GU11, F. hepatica cox1 GenBank sequence (accession no. GU112476.1); No. 1, positive control (adult F. hepatica worm); No. 11, No. 11 F. hepatica positive sample of water dropwort; No. 18, No. 18 F. hepatica positive sample of water dropwort; Fg COX1 AB98, F. gigantica cox1 GenBank sequence (accession no. AB983838.1).
Fig. 4. F. hepatica ITS-2 nucleotide sequences of 2 positive samples obtained from PCR products compared with a GenBank sequence (accession no. AJ272053.1). Base homologies are indicated by a dot (·); base changes are shown in orange. Fh ITS-2 AJ27, F. hepatica ITS-2 GenBank sequence (accession no. AJ272053.1); No. 1, positive control (adult F. hepatica worm); No. 11, No. 11 F. hepatica positive sample of water dropwort; No. 18, No. 18 F. hepatica positive sample of water dropwort; Fg ITS-2 EU26, F. gigantica ITS-2 GenBank sequence (accession no. EU260059.1).
Monitoring of Fasciola Species Contamination in Water Dropwort by COX1 Mitochondrial and ITS-2 rDNA Sequencing Analysis
Target name Oligonucleotide sequence (5’-3’) Product size (bp) GenBank accession No.
Fasciola hepatica COX1 F: TTTGCCTGGGTTTGGAGTTA 283 GU112476.1
R: CCACACAACAGGATCCCATA
Fasciola hepatica ITS-2 F: GTTATAAACTATCACGACGCCCAAA 364 AJ272053.1
R: GAAGACAGACCACGAAGGGTA
Fasciola gigantica COX1 F: GGTCTTTGGGGTGGATTTTT 308 AB983838.1
R: GTCCAACCAACACCCATACC
Fasciola gigantica ITS-2 F: TATCACGACGCCCAAAAAGT 300 EU260059.1
R: CCAAGTTCAGCATCAAACCA
Areas No. of samples No. of PCR positive samples (%)
F. hepatica F. gigantica
A 150 0 (0.0) 0 (0.0)
B 200 1 (0.5) 0 (0.0)
C 150 1 (0.67) 0 (0.0)
Total 500 2 (0.4) 0 (0.0)
Table 1. Primers used for detection of Fasciola hepatica and F. gigantica from water dropwort in Korea

COX1, mitochondrial cytochrome c oxidase subunit 1; ITS-2, nuclear ribosomal internal transcribed spacer 2.

Table 2. Results for the detection of the cox1 and ITS-2 genes of F. hepatica or F. gigantica from water dropwort by PCR