Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Original Article

Validation of Reference Genes for Quantitative Real-Time PCR in Bovine PBMCs Transformed and Non-transformed by Theileria annulata

The Korean Journal of Parasitology 2016;54(1):39-46.
Published online: February 26, 2016

1State Key Laboratory of Veterinary Etiological Biology, Key Laboratory of Veterinary Parasitology of Gansu Province, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou 730046, People’s Republic of China

2Jiangsu Co-innovation Center for Prevention and Control of Important Animal Infectious Diseases and Zoonoses, Yangzhou 225009, People’s Republic of China

3Agricultural College of Ningxia University, Yinchuan 750021, People’s Republic of China

*Corresponding author (guanguiquan@caas.cn; luojianxun@caas.cn)
• Received: February 4, 2015   • Revised: October 17, 2015   • Accepted: November 1, 2015

© 2016, Korean Society for Parasitology and Tropical Medicine

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 12,944 Views
  • 150 Download
  • 12 Web of Science
  • 13 Crossref
  • 14 Scopus
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Virulence Is More than Adhesion and Invasion Ability, an In Vitro Cell Infection Assay of Bovine Mycoplasma spp.
    Elhem Yacoub, Daniel Kos, Murray Jelinski
    Microorganisms.2025; 13(3): 632.     CrossRef
  • A Theileria annulata parasite with a single mutation, methionine 128 to isoleucine (M128I), in cytochrome B is resistant to buparvaquone
    Shahin Tajeri, Debasish Chattopadhyay, Gordon Langsley, Ard M. Nijhof, Vikrant Sudan
    PLOS ONE.2024; 19(4): e0299002.     CrossRef
  • Traditional and emerging Fusarium mycotoxins disrupt homeostasis of bovine mammary cells by altering cell permeability and innate immune function
    Ran Xu, Umesh K. Shandilya, Alexandros Yiannikouris, Niel A. Karrow
    Animal Nutrition.2023; 12: 388.     CrossRef
  • Investigation of Anaplasma marginale, Babesia bovis, Babesia bigemina and Trypanosoma vivax in the brain and spleen of dairy cows of Rio Grande do Sul
    Melânia Lazzari Rigo, Kauê Rodriguez Martins, Yan Wahast Islabão, Alexia Brauner de Mello, Marjorie de Giacometi, Rodrigo Casquero Cunha, Monique Tomazele Rovani, Camila Belmonte Oliveira
    Semina: Ciências Agrárias.2023; 44(6): 2063.     CrossRef
  • 1,25‐Dihydroxyvitamin D3 potentiates the innate immune response of peripheral blood mononuclear cells from Japanese Black cattle
    Youki Oyamada, Ei'ichi Iizasa, Amane Usa, Konosuke Otomaru
    Animal Science Journal.2023;[Epub]     CrossRef
  • Internal reference genes with the potential for normalizing quantitative PCR results for oral fluid specimens
    Ting-Yu Cheng, Jeffrey J. Zimmerman, Luis G. Giménez-Lirola
    Animal Health Research Reviews.2022; 23(2): 147.     CrossRef
  • Genetic diversity of Siberian bovine coronavirus isolates (Coronaviridae: Coronavirinae: Betacoronavirus-1: Bovine-Like coronaviruses)
    Alexander G. Glotov, Aleksej V. Nefedchenko, Anton G. Yuzhakov, Svetlana V. Koteneva, Tatyana I. Glotova, Alina K. Komina, Nikita Yu. Krasnikov
    Problems of Virology.2022; 67(6): 465.     CrossRef
  • Putative Internal Control Genes in Bovine Milk Small Extracellular Vesicles Suitable for Normalization in Quantitative Real Time-Polymerase Chain Reaction
    Md. Matiur Rahman, Shigeo Takashima, Yuji O. Kamatari, Yassien Badr, Kaori Shimizu, Ayaka Okada, Yasuo Inoshima
    Membranes.2021; 11(12): 933.     CrossRef
  • Inhibition monitoring in veterinary molecular testing
    Lifang Yan, Kathy L. Toohey-Kurth, Beate M. Crossley, Jianfa Bai, Amy L. Glaser, Rebecca L. Tallmadge, Laura B. Goodman
    Journal of Veterinary Diagnostic Investigation.2020; 32(6): 758.     CrossRef
  • Development and testing of the real-time polymerase chain reaction for identification and quantitative determination of the bovine respiratory syncytial virus
    A.V. Nefedchenko, A.G. Glotov, S.V. Koteneva, T.I. Glotova
    Molecular Genetics Microbiology and Virology (Russian version).2020; 38(3): 145.     CrossRef
  • Developing and Testing a Real-Time Polymerase Chain Reaction to Identify and Quantify Bovine Respiratory Syncytial Viruses
    A. V. Nefedchenko, A. G. Glotov, S. V. Koteneva, T. I. Glotova
    Molecular Genetics, Microbiology and Virology.2020; 35(3): 168.     CrossRef
  • Subacute ruminal acidosis affects fermentation and endotoxin concentration in the rumen and relative expression of the CD14/TLR4/MD2 genes involved in lipopolysaccharide systemic immune response in dairy cows
    B. Stefanska, W. Człapa, E. Pruszynska-Oszmałek, D. Szczepankiewicz, V. Fievez, J. Komisarek, K. Stajek, W. Nowak
    Journal of Dairy Science.2018; 101(2): 1297.     CrossRef
  • Selection and evaluation of housekeeping genes as endogenous controls for quantification of mRNA transcripts in Theileria parva using quantitative real-time polymerase chain reaction (qPCR)
    Teboho N. Tsotetsi, Nicola E. Collins, Marinda C. Oosthuizen, Kgomotso P. Sibeko-Matjila, Gordon Langsley
    PLOS ONE.2018; 13(5): e0196715.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Validation of Reference Genes for Quantitative Real-Time PCR in Bovine PBMCs Transformed and Non-transformed by Theileria annulata
Korean J Parasitol. 2016;54(1):39-46.   Published online February 26, 2016
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Validation of Reference Genes for Quantitative Real-Time PCR in Bovine PBMCs Transformed and Non-transformed by Theileria annulata
Korean J Parasitol. 2016;54(1):39-46.   Published online February 26, 2016
Close

Figure

  • 0
  • 1
  • 2
  • 3
Validation of Reference Genes for Quantitative Real-Time PCR in Bovine PBMCs Transformed and Non-transformed by Theileria annulata
Image Image Image Image
Fig. 1. The dissociation curve of the 5 candidate reference genes in serial-diluted cDNA samples of T. annulata-transformed cells and PBMCs of uninfected calves.
Fig. 2. Expression levels of 5 candidate reference genes. The range of Ct values across the T. annulata-transformed cells and PBMCs of uninfected calves are exhibited in the boxplot. Ct values of candidate reference genes were widely distributed between 13 to 42 cycles. The horizontal line inside the box represents the median. The bars below and above the box represent the minimum and maximum values of the datasets, respectively.
Fig. 3. The linear relationships between the Ct values and -log10 (concentration) in 5 reference genes from 10-fold serial-diluted cDNA samples of T. annulata-transformed cells and PBMCs of uninfected calves.
Fig. 4. Gene expression stability of the candidate reference genes analyzed by geNorm.
Validation of Reference Genes for Quantitative Real-Time PCR in Bovine PBMCs Transformed and Non-transformed by Theileria annulata
Gene symbol Full name [mRNA NCBI accession ID] Primer sequence (5´-3´) Product size (bp) Average Tm (˚C) Correlation coefficient (R2)
Amplification efficiency (E)
T. annulata transformation cell PBMCs of the uninfected calves T. annulata transformation cell PBMCs of the uninfected calves
18S rRNA Ribosomal subunit Forward:TTCGATGGTAGTCGCTGTGC 99 56 0.9950 0.9936 108.8 103.1
NR_036642.1 Reverse:TTGGATGTGGTAGCCGTTTCT
GAPDH Glyceraldehyde-3-phosphate dehydrogenase Forward: GATGGTGAAGGTCGGAGTGAAC 100 56 0.9674 0.9873 106.7 110.5
NM_001034034.2 Reverse:GTCATTGATGGCGACGATGT
ACTB Cytoskeletal structural protein Forward:GATCTGGCACCACACCTTCTAC 182 56 0.9474 0.9945 114.9 89.9
AY141970.1 Reverse: AGGCATACAGGGACAGCACA
TBP TATA box binding protein Forward:TGAACGTCATGGATCAGAACAACA 114 56 0.9979 0.9526 81.2 104.5
NM_001075742.1 Reverse:TGCCGTAAGGCATCATTGGA
PRKG1 The protein kinase GMP-dependent, type I. Forward:AGCACAAATGGTTTGAGGGCTTTA 140 56 0.8689 0.9670 120.1 99.4
NM_174436.2 Reverse:AGGTGGCGGTTCATCATTGTC
Gene name geNorm
NormFinder
Stability value Ranking Best combination of two genes Stability value Ranking Best combination of 2 genes
18S rRNA 1.207 1 18S rRNA and GAPDH 0.206 1 18S rRNA and GAPDH
GAPDH 1.332 2 0.338 4
ACTB 1.500 4 0.319 3
TBP 1.423 3 0.314 2
PRKG1 1.885 5 0.502 5
Table 1. Sequence information for 5 selected candidate reference genes
Table 2. The candidate reference genes expression stability analysis by geNorm and NormFinder