Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Brief Communication

Complete Mitochondrial Genome of the Chagas Disease Vector, Triatoma rubrofasciata

The Korean Journal of Parasitology 2018;56(5):515-519.
Published online: October 31, 2018

1Ministry of Education Key Laboratory of Contemporary Anthropology, School of Life Sciences, Fudan University, Shanghai, 200438, P. R. China

2National Institute of Parasitic Diseases, Chinese Center for Disease Control and Prevention, Key Laboratory of Parasite and Vector Biology, Ministry of Health, WHO Collaborating Center for Tropical Diseases, Shanghai 200025, P.R. China

*Corresponding author (jingwenwang@fudan.edu.cn)

Theses authors contribute equally to this work.

• Received: July 25, 2018   • Revised: September 23, 2018   • Accepted: September 30, 2018

Copyright © 2018 by The Korean Society for Parasitology and Tropical Medicine

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 9,028 Views
  • 110 Download
  • 9 Web of Science
  • 9 Crossref
  • 11 Scopus
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • The mitogenome of Triatoma brasiliensis brasiliensis (Hemiptera: Reduviidae), the main Chagas disease vector in the semi-arid region of northeastern Brazil
    Carlos E. Almeida, Lifeng Du, Jingwen Wang, Dayane Pires-Silva, Elaine Folly-Ramos, Myrian Harry, Cleber Galvão
    Parasites & Vectors.2025;[Epub]     CrossRef
  • Accidental importation of the vector of Chagas disease, Triatoma rubrofasciata (De Geer, 1773) (Hemiptera, Reduviidae, Triatominae), in Europe
    Francisco Collantes, Juan Francisco Campos-Serrano, Ignacio Ruiz-Arrondo
    Journal of Vector Ecology.2023;[Epub]     CrossRef
  • Variation in the Mitochondrial Genome of the Chagas Disease Vector Triatoma infestans (Hemiptera: Reduviidae)
    Cintia Judith Fernández, Beatriz Alicia García
    Neotropical Entomology.2022; 51(3): 483.     CrossRef
  • The Complete Nucleotide Sequence and Gene Organization of the Mitochondrial Genome of Triatoma boliviana (Hemiptera, Reduviidae, Triatominae) and Phylogenetic Comparisons
    Sebastián Pita, Pablo Mora, Mirko Rojas-Cortez, Teresa Palomeque, Pedro Lorite, Francisco Panzera
    Arthropoda.2022; 1(1): 3.     CrossRef
  • Modelling the climatic suitability of Chagas disease vectors on a global scale
    Fanny E Eberhard, Sarah Cunze, Judith Kochmann, Sven Klimpel
    eLife.2020;[Epub]     CrossRef
  • Phylogeny of the North-Central American clade of blood-sucking reduviid bugs of the tribe Triatomini (Hemiptera: Triatominae) based on the mitochondrial genome
    Magali Aguilera-Uribe, Rubi Nelsi Meza-Lázaro, Troy J. Kieran, Carlos N. Ibarra-Cerdeña, Alejandro Zaldívar-Riverón
    Infection, Genetics and Evolution.2020; 84: 104373.     CrossRef
  • Mitochondrial genomes of three kissing bugs (Reduviidae: Triatominae) and their phylogenetic implications
    Yisheng Zhao, Manjie Jiang, Yunfei Wu, Fan Song, Wanzhi Cai, Hu Li
    International Journal of Biological Macromolecules.2019; 134: 36.     CrossRef
  • Mitogenome analysis of Indian isolate of Rhipicephalus microplus clade A sensu ( ): A first report from Maritime South-East Asia
    Arun Kumar De, Ramachandran Muthiyan, Perumal Ponraj, K. Muniswamy, Jai Sunder, A. Kundu, D. Karunakaran, Zachariah George, M.S. Kundu, S.K. Zamir Ahmed, Dhruba Malakar, D. Bhattacharya
    Mitochondrion.2019; 49: 135.     CrossRef
  • Biological attributes of the kissing bug Triatoma rubrofasciata from Vietnam
    Ho Viet Hieu, Le Thanh Do, Sebastián Pita, Hoang Ha, Pham Thi Khoa, Pham Anh Tuan, Ta Phuong Mai, Ngo Giang Lien, Francisco Panzera
    Parasites & Vectors.2019;[Epub]     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Complete Mitochondrial Genome of the Chagas Disease Vector, Triatoma rubrofasciata
Korean J Parasitol. 2018;56(5):515-519.   Published online October 31, 2018
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Complete Mitochondrial Genome of the Chagas Disease Vector, Triatoma rubrofasciata
Korean J Parasitol. 2018;56(5):515-519.   Published online October 31, 2018
Close

Figure

  • 0
  • 1
Complete Mitochondrial Genome of the Chagas Disease Vector, Triatoma rubrofasciata
Image Image
Fig. 1 Graphical map of the complete mitochondrial genome of Triatoma rubrofasciata. Genes encoded by the heavy strand were shown outside the circle, and genes encoded by the light strand were shown inside the circle, respectively. The GC content of the genome were shown in the inner circle.
Fig. 2 Phylogenetic tree based on Maximum likelihood analysis of 13 protein-coding genes. Sequence from the present study was indicated with a blue font. Apolygus lucorum and Corythucha ciliate were used as outgroup. Bootstrap support values were displayed at each node.
Complete Mitochondrial Genome of the Chagas Disease Vector, Triatoma rubrofasciata

Primer sequences used to amplify PCR fragments of Triatoma rubrofasciata

Primer name Sequences (5′-3′) Size (kb)
Tr-1 ACCGCCTATTAATTCAGCCACTT
GCGTGTTCTTAGTCGAAGACTTGTT
~7k
Tr-2 ACACCCGCAGTAACCAAAGTAGAAG
AGGATGTAAGGTTCTTCAGCAGGAC
~4k
Tr-3 ACCATCTCGTCCGTTATCTTCTTCT
GCGGTTATACAATAGGAGCGAGTGA
~4k
Tr-4 AAACGAGAGTGACGGGCGATATG
GTTCATCCTGTTCCTGCTCCTCTT
~4k
Tr-5 TGGAAATGATGTCTTGGTTGCTA
TCAGAAAGACCTATGTACCTAAGAA
~2k

Annotation of the complete mitochondrial genome of Triatoma rubrofasciata. tRNA abbreviations follow the IUPAC-IUB three letter code. For other abbreviation see legend for Fig. 1.

Gene Stand Nucleotide number Anticodon Start codon Stop codon
tRNA-Ile H 1-67 33-35 GAT - -
tRNA-Gln L 65-133 101-103 TTG - -
tRNA-Met H 133-200 163-165 CAT - -
ND2 H 219-1199 - ATT TAG
tRNA-Trp H 1206-1271 1236-1238 TCA - -
tRNA-Cys L 1264-1325 1293-1295 GCA - -
tRNA-Tyr L 1327-1392 1358-1360 GTA - -
COI H 1394-2922 - ATG T(aa)
tRNA-Leu H 2928-2996 2961-2963 TAA - -
COII H 2997-3672 - ATT T(aa)
tRNA-Lys H 3676-3745 3706-3708 CTT - -
tRNA-Asp H 3745-3808 3775-3777 GTC - -
ATP8 H 3809-3967 - ATC TAA
ATP6 H 3961-4644 - ATG TAA
COIII H 4631-5416 - ATG TA(a)
tRNA-Gly H 5416-5478 5446-5448 TCC - -
ND3 H 5476-5832 - ATA TAA
tRNA-Ala H 5833-5894 5862-5864 TGC - -
tRNA-Arg H 5898-5961 5927-5929 TCG - -
tRNA-Asn H 5973-6036 6003-6005 GTT - -
tRNA-Ser(AGN) H 6036-6108 6060-6062 GCT - -
tRNA-Glu H 6108-6168 6137-6139 TTC - -
tRNA-Phe L 6171-6234 6201-6203 GAA - -
ND5 L 6234-7946 - ATT TAA
tRNA-His L 7944-8009 7975-7977 GTG - -
ND4 L 8012-9340 - ATG TAA
ND4L L 9334-9627 - ATG TAA
tRNA-Thr H 9630-9692 9660-9662 TGT - -
tRNA-Pro L 9693-9757 9626-9628 TGG - -
ND6 H 9761-10261 - ATG TAA
CytB H 10261-11391 - ATG TAG
tRNA-Ser(UCN) H 11393-11459 11422-11424 TGA - -
ND1 L 11641-12573 - ATT TAA
tRNA-Leu L 12559-12624 12593-12595 TAG - -
lrRNA L 12625-13890 - - -
tRNA-Val L 13879-13949 13915-13917 TAC - -
srRNA L 13952-14722 - - -
Control region 14723-17150 - - -
Table 1 Primer sequences used to amplify PCR fragments of Triatoma rubrofasciata
Table 2 Annotation of the complete mitochondrial genome of Triatoma rubrofasciata. tRNA abbreviations follow the IUPAC-IUB three letter code. For other abbreviation see legend for Fig. 1.