Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Original Article

Characterization of Plasmodium berghei Homologues of T-cell Immunomodulatory Protein as a New Potential Candidate for Protecting against Experimental Cerebral Malaria

The Korean Journal of Parasitology 2019;57(2):101-115.
Published online: April 30, 2019

Department of Pathogen Biology, College of Basic Medical Sciences, China Medical University, Shenyang, Liaoning 110122, P.R. China

*Corresponding author (enjie359@163.com)
• Received: October 14, 2018   • Revised: April 14, 2019   • Accepted: April 16, 2019

Copyright © 2019 by The Korean Society for Parasitology and Tropical Medicine

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 10,052 Views
  • 131 Download
  • 2 Web of Science
  • 2 Crossref
  • 3 Scopus
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Malian children infected with Plasmodium ovale and Plasmodium falciparum display very similar gene expression profiles
    Kieran Tebben, Salif Yirampo, Drissa Coulibaly, Abdoulaye K. Koné, Matthew B. Laurens, Emily M. Stucke, Ahmadou Dembélé, Youssouf Tolo, Karim Traoré, Amadou Niangaly, Andrea A. Berry, Bourema Kouriba, Christopher V. Plowe, Ogobara K. Doumbo, Kirsten E. Ly
    PLOS Neglected Tropical Diseases.2023; 17(1): e0010802.     CrossRef
  • Characterization of protein cargo of Echinococcus granulosus extracellular vesicles in drug response and its influence on immune response
    María Celeste Nicolao, Christian Rodriguez Rodrigues, Magalí B. Coccimiglio, Camila Ledo, Guillermo H. Docena, Andrea C. Cumino
    Parasites & Vectors.2023;[Epub]     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Characterization of Plasmodium berghei Homologues of T-cell Immunomodulatory Protein as a New Potential Candidate for Protecting against Experimental Cerebral Malaria
Korean J Parasitol. 2019;57(2):101-115.   Published online April 30, 2019
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Characterization of Plasmodium berghei Homologues of T-cell Immunomodulatory Protein as a New Potential Candidate for Protecting against Experimental Cerebral Malaria
Korean J Parasitol. 2019;57(2):101-115.   Published online April 30, 2019
Close

Figure

  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • 7
Characterization of Plasmodium berghei Homologues of T-cell Immunomodulatory Protein as a New Potential Candidate for Protecting against Experimental Cerebral Malaria
Image Image Image Image Image Image Image Image
Fig. 1 Bioinformatic analyses of PbTIP. (A) Schematic diagram of PbTIP showing the total length of PbTIP, a signal peptide and transmembrane domain. The E. coli expression segment shows 204–335 AA. (B) Alignment of protein sequences of PbTIP in Plasmodium species: P. berghei (Pb), P. vivax (Pv), P. falciparum (Pf), and P. yoelii (Py).
Fig. 2 Recombinant PbTIP protein purification and immunization. (A) rPbTIP was purified and separated on 10% SDS-PAGE gel. (B) rPbTIP-antibody titers in immunized BALB/c mice. Serum samples from immunized and control mice were collected post-immunization on days 14, 35, and 56. The data represented 3 separate experiments. Error bars were presented as mean±SD. SD indicates the assay variance. (C) ELISA showing total IgG titer of anti-rPbTIP at 10 days. Mean of control antisera±3×SD represents the broken lines. IgG titers correspond to the last dilution of anti-rPbTIP sera in which the OD490 values were above the cut-off value. The cut-off value was defined as the pooled sera from control mice. Results are representative of 3 independent experiments. M, molecular weight marker. **P<0.01 (Student’s t-test).
Fig. 3 Expression and localization of PbTIP in the parasites. (A) Western blot of PbTIP in asexual and sexual stage parasites. Parasite antigens from isolated cytoplasmic, nuclear and membrane protein (30 μg/lane) of schizonts, gametocytes and ookinetes were incubated with anti-rPbTIP antisera (1:100). Anti-HSP70 was used as positive control. (B) Blood smears from parasite samples were stained at different stages after collecting the P. berghei infected blood. Parasites were fixed and stained with anti-rPbTIP sera and then with FITC-conjugated goat anti-mouse IgG (green). Nuclei were labeled with DAPI (blue). Positive control-Pbs21 mAb. Scale-bars: 5 μm. BF, bright field.
Fig. 4 rPbTIP i.v. injection group showed improved host survival. (A) Dynamics of parasitaemia was monitored for 17 days. (B) Cumulative survival analysis. rPbTIP i.v. injection group and PBS i.v. injection group were monitored daily for survival. *P<0.05; log-rank test.
Fig. 5 (A) i.v. injection of rPbTIP reduced endothelium activation and BBB leakage. On day 6 p.i., infected mice from each group were processed for histology using HE staining and immunohistochemical analysis with anti-VCAM-1, ICAM-1 and CD36 antibodies. The Kruskal-Wallis test was used for 3-group comparisons, and Dunn’s test was employed for post hoc analysis. Top panel: Representative brain images showing the extent of vascular leakage, while the corresponding bar graphs showing the quantification of BBB leakage. Significant difference was observed between PBS i.v. injection group and rPbTIP i.v. injection group (*P<0.05). Bottom 4 panels: Representative images of brain sections with the microvessels (arrows), and accordingly the bar graphs indicate quantification of VCAM-1, ICAM-1, CD36, and leukocytes-positive microvessels. Microvessels per microscopic field were quantified in 20 fields per mouse, values are presented as mean±SEM from 5 mice of each group. (B) Quantitation of mRNA levels of adhesive molecules and chemokines in brain tissues by qRT-PCR. On day 0 and days 2, 4, 6, and 8 post-infection, 5 mice were used for each group. Results are representatives of 3 independent experiments. Total RNA was extracted from the brains, qRT-PCR with β-actin as the internal reference. *P<0.05, and **P<0.01 indicate the comparison with the uninfected group. #P<0.05 and ##P<0.01 for comparison between rPbTIP i.v. injection group and PBS group (2-way ANOVA).
Fig. 6 Proteins and transcripts of proinflammatory cytokines in spleens. (A–D) The levels of IFN-γ, TNF-α, IL-1, and IL-12 in splenocyte culture supernatants were measured by ELISA. Each experiment was repeated 3 times. Values are presented as mean±SEM for 5 mice in each group. *P<0.05, and **P<0.01, for comparison between rPbTIP i.v. injection group and PBS mice. (E–H) Quantitation of mRNA levels of pro-inflammatory cytokines in spleens by qRT-PCR. On day 0 and days 2, 4, 6, and 8 post-infection, 5 mice were used for each group. Results are representatives of 3 independent experiments. Total RNA was extracted from the spleens, and relative expression of individual genes was quantified with β-actin as the internal reference. *P<0.05, and **P<0.01 indicate the comparison with the uninfected group. #P<0.05 and ##P<0.01 for comparison between WT P. berghei ANKA infected by i.v injection of rPbTIP and PBS groups (2-way ANOVA).
Fig. 7 The expansion of Tregs and increased production of anti-inflammatory cytokines (IL-10 and TGF-β). (A–C) Tregs were quantified by flow cytometry. rPbTIP i.v. elicited the expansion of Tregs. (A) Representative dot plots of Tregs in spleens was detected by flow cytometry. (B, C) The absolute numbers and the proportion of Tregs. On day 0 and days 2, 4, 6, and 8 post-infection, 5 mice were euthanized for each group. Results are representatives of 3 independent experiments. Value sare presented as mean±SEM. *P<0.05, and **P<0.01 indicate the comparison with the uninfected group. #P<0.05 and ##P<0.01 for comparison between rPbTIP i.v. injection group and PBS group (2-way ANOVA).
Fig. 8 The concentrations of IL-10 and TGF-β in serum cultured splenocytes and serum by ELISA. Both cytokine levels were harvested from the same culture supernatant and serum. (A, B) IL-10 and TGF-β were determined in cultured splenocytes. (C, D) IL-10 and TGF-β were measured in the serum. Results are representatives of 3 independent experiments. Data were presented as mean±SEM. *P<0.05, and **P<0.01 for comparison between WT P. berghei ANKA infected by i.v injection of rPbTIP and PBS groups (2-way ANOVA).
Characterization of Plasmodium berghei Homologues of T-cell Immunomodulatory Protein as a New Potential Candidate for Protecting against Experimental Cerebral Malaria

Primers for quantitative real-time PCR

Target gene Forward Reverse
β-actin GATTACTGCTCTGGCTCCTAGC GACTCATCGTACTCCTGCTTGC
ICAM-1 GGCAGCAAGTAGGCAAGGAC CTGGCGGCTCAGTATCTCCT
VCAM-1 CCTCACTTGCAGCACTACGG CATGGTCAGAACGGACTTGG
CD36 CCCTCCAGAATCCAGACAAC CACAGGCTTTCCTTCTTTGC
CXCL9 CCGAGGCACGATCCACTACA AGTCCGGATCTAGGCAGGTTTG
CXCL10 GCCGTCATTTTCTGCCTCAT GCTTCCCTATGGCCCTCATT
CXCR3 AAGTGCCAAAGGCAGAGAAG AAAGTCCGAGGCATCTAGCA
IL-12 TTTGCTGGTGTCTCCACTCA CATCTTCTTCAGGCGTGTCA
IL-1β GCTGCTTCCAAACCTTTGAC AGCTTCTCCACAGCCACAAT
TNF-α TATGGCTCAGGGTCCAACTC CCCATTTGAGTCCTTGATGG
IFN-γ TGATCCTTTGGACCCTCTGA ACAGCCATGAGGAAGAGCTG
TGF-β AGCAACAATTCCTGGCGTTACCTT CCTGTATTCCGTCTCCTTGGTTCAG
IL-10 CTATGCTGCCTGCTCTTACTGACTG GAGTCGGTTAGCAGTATGTTGTCCAG
Table 1 Primers for quantitative real-time PCR