Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Original Article

Genotyping of Blastocystis species in hemodialysis patients from Makkah, Saudi Arabia

Parasites, Hosts and Diseases 2026;64(1):62-69.
Published online: January 19, 2026

1Department of Medical Laboratory Sciences, Faculty of Applied Medical Sciences, King Abdulaziz University, Jeddah, Saudi Arabia

2Special Infectious Agents Unit, King Fahd Medical Research Center, King Abdulaziz University, Jeddah, Saudi

3Microbiology Section, Department of Pathology and Laboratory Medicine, King Faisal Specialist Hospital & Research Centre, Jeddah, Saudi Arabia

4Department of Biological Sciences, College of Science, University of Jeddah, Jeddah, Saudi Arabia

5Department of Biological Sciences, Faculty of Science, King Abdulaziz University, Jeddah, Saudi Arabia

6Department of Animal Production, Faculty of Agriculture, Sana'a University, Sana'a, Yemen

7Department of Medical Parasitology, Faculty of Medicine, South Valley University, Qena, Egypt

*Correspondence mwakid@kau.edu.sa

Citation Gattan HS, Bahwaireth EO, Wakid MH, Alsulami MN, Al-Matary MA, El-Kady AM. Genotyping of Blastocystis species in hemodialysis patients from Makkah, Saudi Arabia. Parasites Hosts Dis 2026;64(1):62-69.

• Received: July 2, 2025   • Accepted: October 27, 2025

© 2026, Korean Society for Parasitology and Tropical Medicine

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 821 Views
  • 28 Download
prev next
  • The human gut is host to a diversity of microorganisms, including a parasite called Blastocystis. While there are increasing reports characterizing Blastocystis subtypes (STs) among healthy individuals, only a few studies have investigated the Blastocystis STs in renal or dialysis patients. This study investigates the Blastocystis prevalence and STs in hemodialysis patients. Fifty healthy controls and 100 chronic kidney disease patients undergoing dialysis participated in the study. Blastocystis infection was identified by using microscopic and molecular diagnosis using 18S rRNA-PCR. Then all positive samples were sent for sequencing to identify which ST they belong to. Phylogenetic and pairwise distance analyses were performed to confirm the validity of the STs. Thirty-four hemodialysis patients were infected with Blastocystis while 17 patients in the control were infected with the parasite. All positive samples were then confirmed using PCR. Genetic sequencing analysis subsequently revealed that 66% of Blastocystis infection belonged to ST1 and ST3 (33% each), followed by ST10 (20%), and ST6 (14%). The nucleotide sequence analysis of the 385 bp 18S rRNA gene revealed a >97% identity with previously identified Blastocystis isolates. The genetic analysis showed that the 8 identified isolates correspond to previously observed alleles. Six ST1 isolates produced a high frequency of Blastocystis isolates matching allele 4, with very low genetic divergence. ST3 isolates showed relatively increased genetic diversity and matching allele 34, which is the most common allele worldwide.
Blastocystis is a protozoan parasite that could infect both humans and animals. It was first reported in 1912 from human stool samples and diagnosed as a yeast but now it is classified as an intestinal parasite. Most of the infection is believed to be asymptomatic; however, some of the infected cases shown symptoms [1]. It is believed that Blastocystis may contribute to bowel disorders such as irritable bowel syndrome and inflammatory bowel disease [2].
Significant genetic diversity has been observed among various Blastocystis sp. strains isolated from different hosts [3]. Thirty-eight subtypes (STs; ST1–ST38) have been obtained from humans and animals worldwide [4,5], while other STs have been found only in animals [6]. It appears that STs 1, 2, 3 and 4 are the most common in human while the other 10 STs are frequently detected in other various animal groups such as birds and hoofed animals [6,7]. Different epidemiological aspects have been investigated by molecular studies such as transmission route, host specificity, and chemotherapeutic drug resistance.
Hemodialysis (HD) patients are highly vulnerable to severe infections since there are immunosuppressed. These patients are immunocompromised for various reasons, including the impairment of granulocyte and lymphocyte functions due to uremic toxins and malnutrition.
Due to weakened immunity, HD patients are more susceptible to various parasitic infections that can negatively affect their quality of life [8]. Studies on the prevalence of parasitic infections among HD patients in Brazil, Turkey, Iran, and Saudi Arabia have revealed that Blastocystis sp. is among the most frequently identified microorganisms, in addition to Cryptosporidium, Endolimax nana, Entamoeba coli, Entamoeba histolytica, and Entamoeba dispar, and Giardia lamblia [9-12]. Despite the significant burden of Blastocystis sp. in humans, there is limited molecular research available that provides data on the prevalence and distribution of its STs in the Saudi population [13,14]. To date, no data are available on the prevalence and genotyping of Blastocystis in Saudi HD patients. Therefore, in this study, we aimed to investigate the Blastocystis prevalence and to identify the parasite STs in HD patients.
Ethics statement
The study was conducted after ethical approval (No.1439-280594) from the Medical Ethics Committee of the Saudi Ministry of Health, Makkah, Saudi Arabia, and informed consent form was signed by each participant.
Samples collections
The samples of the present study were collected from Saudi patients attending Al-Noor Specialist Hospital and King Faisal Hospital in Makkah, Saudi Arabia. Fifty healthy controls and 100 chronic kidney disease Saudi patients undergoing dialysis participated in the study. Each participant provided a stool sample in a clean dry container labelled with the patient’s name, then each sample was subjected to microscopic and molecular examinations.
Microscopic examination
The first step was the microscopic examination to detect the presence of Blastocystis using direct smears, formol-ether concentration technique (Ritchie), and trichrome stating, as previously described [15].
Primer design
Different Blastocystis hominis 18S ribosomal RNA gene sequences were extracted from GenBank (https://www.ncbi.nlm.nih.gov/nucleotide/) and aligned using Clustal W to look for conserved regions for primer design. After the alignment was done, the best pair of primers were chosen and then checked using Primer blast to check the annealing temperature and the GC percentage (Table 1).
DNA extraction and PCR amplification
Samples tested for Blastocystis underwent DNA extraction, PCR, and sequencing. DNA was extracted from stool samples using the QIAamp Fast DNA Stool Mini Kit (Qiagen), following the manufacturer’s instructions. PCR was done using specific primers for Blastocystis amplifying 18S rRNA gene. The PCR conditions were as follows: The standard protocols followed for amplification that was: denaturation (95°C) for 5 min, 40 cycles for 40 sec at 95°C, annealing at a temperature 52°C for 40 sec, elongation at 72°C for 1 min with final elongation at 72°C for 10 min. Then electrophoresis on 1.5% agarose gels was used to isolate PCR products which were then visualized using UV. A 385-bp band was produced by positive Blastocystis sp. samples.
Sequencing and phylogenetic analysis
Eight positive 18S rRNA-PCR samples (385 bp) were selected and purified using the QIAquick PCR Purification Kit (Qiagen). These purified samples were then subjected to Sanger DNA sequencing with an automated DNA sequencer (ABI 3730XL DNA Analyzer). The sequences were analyzed using DNA BaserV3 software (Heracle BioSoft SRL).
The sequence similarity was performed using BLASTN search in GenBank (http://www.ncbi.nlm.nih.gov/BLAST). Subtyping of Blastocystis sp. was done by uploading sequences data to PubMLST through the web interface (https://pubmlst.org).
The alignment of small subunit ribosomal RNA sequences was conducted using the ClustalW in the MEGA version 12 (https://megasoftware.net) and gaps and ambiguous sequences were removed by ocular inspection. Phylogenetic analyses using the neighbor-joining method and pairwise distances were performed. The phylogenetic tree for partial 18S rRNA sequences of Blastocystis sp. was constructed using the neighbor-joining method in MEGA. The Kimura 2-parameter model was applied, and bootstrap analysis with 1,000 replicates was performed to assess the reliability of the tree.
Statistical analysis
The collected data were analysed using IBM SPSS version 25 (IBM Corp.). Chi-square test was used to analyse categorical variables and P-value of <0.05 was considered significant. Kappa coefficient was used to measure reliability for different techniques used in the present study.
A total of 150 stool samples were collected from 100 HD patients (mean±SD, 51.57±10.5 years) and 50 healthy controls (mean±SD, 39.66±11.9 years). Most of the HD patients and control were male (55 out of 100 HD patients and 34 out of 50 control). Some HD patients and control cases had gastrointestinal manifestations as abdominal pain, nausea, vomiting, and diarrhoea as shown in Table 2.
All stool samples were examined for the presence of Blastocystis by microscopy and conventional PCR. Microscopic examination showed that 34% (34/100) of the HD patients were infected with B. hominis in comparison to 34% (17/50) of the healthy control who were infected with the parasite (Table 3).
Among HD patients, using direct smear, Blastocystis was detected in 31 cases (31%), while Ritchie technique detected Blastocystis in 20 cases (20%). PCR diagnosed Blastocystis in 31 participants (31%). The total number of infected participants detected by all techniques was 34 (34%).
As shown in Table 4, when direct smears proposed to be the gold standard method for detection, substantial agreement (0.764) was found with Ritchie technique, and perfect agreement (0.831) with real-time PCR. However, when Ritchie technique assumed to be the gold standard, substantial agreement was found with direct smears and real-time PCR. Then, when real-time PCR was nominated to be the gold standard, fair agreement was found with direct smears, and substantial agreement with Ritchie technique.
Among the 34 HD patients infected with Blastocystis, males were at a higher percentage (21/55, 38.2%) compared to females (13/45, 29.9%). Table 5 shows the distribution of clinical characteristics (abdominal pain, nausea, vomiting, and diarrhoea) among HD patients. Blastocystis infection was more commonly associated with abdominal pain (64.7%) than other gastrointestinal symptoms. There were no statistically significant differences between the 2 groups in any of the variables studied, including gender (P=0.329), abdominal pain (P=0.689), nausea (P=0.666), vomiting (P=0.948), and diarrhoea (P=0.758).
DNA was extracted from all the positive samples, then PCR amplification of the 18S rRNA gene was successfully done for all samples (Fig. 1). Then, all the PCR products were sent to Macrogen for sequencing. Eight different sequences were obtained. The obtained sequences were analysed using BLASTN software for comparison with the 18S rRNA sequences deposited in the GenBank. The nucleotide sequence analysis of the 385 bp 18S rRNA gene revealed a >97% identity with previously identified Blastocystis isolates. Sequence analysis showed that the majority of Blastocystis isolated in the present study belong to Blastocystis sp. ST1 (33%) and ST3 (33%). ST10 was identified in 20% and ST6 in 14% of samples. The results of allele discrimination revealed the presence of alleles 4 in all ST1 samples. ST3 exhibited alleles 34, 38, and 59. ST6 represented alleles 122 only. The only ST10 was allele 152.
The phylogenetic analysis of Blastocystis sp. revealed that 6 different sequences were on the same clade as Blastocystis ST1 and 2 sequences were placed on the same clade as Blastocystis ST3 (Fig. 1). Two zoonotic STs, ST1 (6/8, 75%) and ST3 (2/8, 25%) were detected in this study. Among them, ST1 infection was the predominant and the related isolates were placed on 2 branches of the same clade as ST1b and ST1c with 37% nodal support (Fig. 2). Further, the phylogenetic tree revealed that Blastocystis isolates in the present study were most closely related to Blastocystis isolates from Thailand and grouped with isolates from the Middle East, Asia, North Africia, Ecuador, Spain, and the Dominican Republic.
As shown in Fig. 3, the pairwise distance of the Blastocystis sequences obtained in this study revealed that the overall mean distance is 0.25, and between them and the previous Saudi Blastocystis sequence (OL375688) retrieved from the GenBank database is 0.29. The 8 nucleotide sequences generated in this study have been deposited in GenBank under accession numbers OP901517 to OP901524. The sequence identity of OP901519 and OP901520 was 100% and ranged from 99.4%–99.9% among the remaining 6 sequences.
In the current study, 22 out of 34 Blastocystis positive HD participants (64.7%) were complaining of abdominal pain. Regarding other symptoms including diarrhea, nausea and vomiting, Blastocystis infection was diagnosed more in asymptomatic cases. The pathogenic potential of Blastocystis remains controversial, as the parasite has been found in both symptomatic and asymptomatic cases in several investigations worldwide [13-20].
According to earlier findings, ST1 and ST3 are the STs that are most commonly seen in both humans and animals [21,22]. In Saudi Arabia, 4 STs (ST1, ST2, ST3, and ST5) have been detected at varying frequencies using PCR and sequencing in some studies that investigated the occurrence and subtyping of Blastocystis sp., primarily in Makkah and Taif [13,14]. However, using genetic analysis of Blastocystis isolates, 2 STs of Blastocystis sp. were identified in this study: ST1 and ST3. Of these, ST1 was the most widely distributed (75%) and ST3 was the least (25%). Previous research in Saudi Arabia [13], Libya [21], Turkey [23], United Arab Emirates [24], Iran [25], and Syria [26], have shown similar results. In contrast, previous studies have reported that the most distributed ST was ST3 followed by ST1 or ST4 [27-32]. The high frequency of Blastocystis ST1 and ST3 infections in Saudi patients shows that the majority of infections are passed between persons. Several previous studies reported that ST1 and ST3 are associated to gastrointestinal symptoms, such as abdominal pain, diarrhoea, vomiting, and flatulence [3,20,26,29,33,34].
In the present study, the genetic analysis showed that the 8 identified isolates correspond to previously observed alleles. Six ST1 isolates produced a high frequency of Blastocystis isolates matching allele 4, with very low (0.04) genetic divergence. ST3 isolates (n=2) showed relatively increased genetic diversity (various nucleotide substitution ranged from 0.021 to 0.56) and matching allele 34 (the most common allele worldwide). In Egypt, ST1 and ST2 isolates were found with genetic diversity ranging from 1 to 11 nucleotide substitutions and ST3 isolates were found with low genetic divergence over 4 nucleotide substitutions [27]. Another study reported that among 11samples analysed, ST1 allele 4, ST2 alleles 9 and 12, and ST3 allele 34 were detected, with ST2 isolates showing low genetic diversity and numerous nucleotide changes [30].
Phylogenetic analysis of the 18S rRNA gene is useful for characterizing Blastocystis sp. Eight 18S rRNA sequences from Makkah were identified as Blastocystis sp. The phylogenetic tree based on 18S rRNA was beneficial in inferring the association between Saudi isolates from diverse regions, with a high bootstrap value. The Saudi isolates in this investigation and those received from GenBank were divided into 4 branches, and the collected isolates were divided into 3 haplotypes, ST1b, ST1c, and ST3. Furthermore, the examination of Blastocystis sp. 18S rRNA revealed genetic diversity within a single host, with at least 4 groups from different localities (this study and Dammam). This Saudi pattern illustrates how various Blastocystis genotypes have distinct geographic distributions in patients and exhibit diverse spreads in the Saudi Arabia. A previous study conducted in Egypt found that each Blastocystis sp. STs constituted a separate clade and that, based on phylogenetic analysis, the 11 Blastocystis sequences grouped into 3 STs (ST1, ST2, and ST3) with strong bootstrap value [30]. In another study, the same phylogenetic pattern was reported with ST1 and ST3 clusters in patients with irritable bowel syndrome [35]. The coevolution patterns between the parasite and its host are probably reflected in the phylogenetic analysis of genetically diverse Blastocystis isolates that differed in their ancestral and epidemiological characteristics.
The current study lacks information regarding environmental or animal contact. Future epidemiological studies are needed to evaluate the influence of environmental factors, animal interactions, and foreign travel history to determine the persistence of Blastocystis.

Author contributions

Conceptualization: Bahwaireth EO, Wakid MH, Alsulami MN, Al-Matary MA. Data curation: Gattan HS, Bahwaireth EO, Wakid MH, Al-Matary MA, El-Kady AM. Formal analysis: Gattan HS, Bahwaireth EO, Wakid MH, Alsulami MN, Al-Matary MA, El-Kady AM. Funding acquisition: Bahwaireth EO. Investigation: Gattan HS, Bahwaireth EO, Wakid MH, Alsulami MN, Al-Matary MA, El-Kady AM. Methodology: Bahwaireth EO, Wakid MH, Alsulami MN, Al-Matary MA. Project administration: Wakid MH. Software: Bahwaireth EO. Supervision: Wakid MH. Writing – original draft: Gattan HS, Bahwaireth EO, Alsulami MN, Al-Matary MA, El-Kady AM. Writing – review & editing: Wakid MH.

Conflict of interest

The authors have no conflicts of interest to declare.

Acknowledgments

The authors are very thankful to all the associated personnel for their beneficial help and cooperation.

Fig. 1.
Electropherogram of the 1.5% agarose gel showing 385 bp PCR product of the 18S rRNA was successfully amplified for all the samples from hemodialysis patients. Arrow indicates band size. L, ladder.
PHD-25052f1.jpg
Fig. 2.
Neighbor-joining tree of Blastocystis sp. based on the 18S rRNA nucleotide sequences showing the phylogenetic relationship of Blastocystis sp. collected in Saudi Arabia in the present study (black circles) with other Blastocystis isolates available in GenBank. The tree was constructed using the Kimura-2-parameter model. Bootstrap values are shown at the nodes of branches (1,000 replicates). Each sequence was identified by its GenBank accession number, country, and subtype (ST).
PHD-25052f2.jpg
Fig. 3.
Pairwise distances between Blastocystis isolates of this study, and Blastocystis sp. (OL375688) partial-length 18S rRNA gene sequence showing the number of base substitutions per site from between sequences. Analyses were conducted using the maximum composite likelihood model and included 9 nucleotide sequences. Codon positions included were 1st+2nd+3rd+noncoding. All positions containing gaps and missing data were eliminated. There was a total of 257 positions in the final dataset.
PHD-25052f3.jpg
Table 1.
PCR primers specific for 18S rRNA gene of Blastocystis hominis
Table 1.
Primer Sequence (5’–3’) Target Blastocystis subtype Specificity Annealing temperature (°C) Product size (bp)
18S rRNAF ACTGCGAATGGCTCATTATAT All 18S rRNA 54 385
18S rRNAR GCATTGTGATTTATTGTCACTACC All 18S rRNA 54 385
Table 2.
Demographic and gastrointestinal characteristics of the study group
Table 2.
Variable Hemodialysis patients (n=100) Normal control (n=50) P-value
Age (yr) 51.57± 10.5 39.66+11.9 -
Sex Male 55 34 0.127
Female 45 16
Abdominal pain Yes 62 20 0.010
No 38 30
Nausea Yes 47 17 0.130
No 53 33
Vomiting Yes 29 4 0.003
No 71 46
Diarrhoea Yes 42 11 0.016
No 58 39

Values are presented as mean±SD or number.

Table 3.
Blastocystis infection among hemodialysis cases and healthy controls according to sex
Table 3.
Hemodialysis patients Normal control
Female (n=45) Male (n=55) Total (n=100) Female (n=16) Male (n=34) Total (n=50)
Positive 13 21 34 7 10 17
Negative 32 34 66 9 24 33

Values are presented as number.

Table 4.
Agreement between techniques used to detect Blastocystis hominis, in relation to direct smears, Ritchie technique, and real-time PCR
Table 4.
N P κ Agreement
Direct smears Ritchie technique N TN103 FN14 0.764 Substantial
P FP0 TP33
Real-time PCR N TN97 FN5 0.831 Perfect
P FP6 TP42
Ritchie technique Direct smears N TN103 FN0 0.764 Substantial
P FP14 TP33
Real-time PCR N TN99 FN3 0.649 Substantial
P FP18 TP30
Real-time PCR Direct smears N TN97 FN6 0.831 Perfect
P FP5 TP42
Ritchie technique N TN99 FN18 0.649 Substantial
P FP3 TP30

N, negative; P, positive; κ, kappa coefficient; TN, true negative; FN, false negative; FP, false positive; TP, true positive.

Table 5.
Sex and clinical characters of hemodialysis patients
Table 5.
Variable Positive (n=34) Negative (n=66) P-value
Sex Male 21 34 0.329
Female 13 32
Abdominal pain Yes 22 40 0.689
No 12 26
Nausea Yes 17 30 0.666
No 17 36
Vomiting Yes 10 19 0.948
No 24 47
Diarrhoea Yes 15 27 0.758
No 19 39

Values are presented as number.

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Genotyping of Blastocystis species in hemodialysis patients from Makkah, Saudi Arabia
Parasites Hosts Dis. 2026;64(1):62-69.   Published online January 19, 2026
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Genotyping of Blastocystis species in hemodialysis patients from Makkah, Saudi Arabia
Parasites Hosts Dis. 2026;64(1):62-69.   Published online January 19, 2026
Close

Figure

  • 0
  • 1
  • 2
Genotyping of Blastocystis species in hemodialysis patients from Makkah, Saudi Arabia
Image Image Image
Fig. 1. Electropherogram of the 1.5% agarose gel showing 385 bp PCR product of the 18S rRNA was successfully amplified for all the samples from hemodialysis patients. Arrow indicates band size. L, ladder.
Fig. 2. Neighbor-joining tree of Blastocystis sp. based on the 18S rRNA nucleotide sequences showing the phylogenetic relationship of Blastocystis sp. collected in Saudi Arabia in the present study (black circles) with other Blastocystis isolates available in GenBank. The tree was constructed using the Kimura-2-parameter model. Bootstrap values are shown at the nodes of branches (1,000 replicates). Each sequence was identified by its GenBank accession number, country, and subtype (ST).
Fig. 3. Pairwise distances between Blastocystis isolates of this study, and Blastocystis sp. (OL375688) partial-length 18S rRNA gene sequence showing the number of base substitutions per site from between sequences. Analyses were conducted using the maximum composite likelihood model and included 9 nucleotide sequences. Codon positions included were 1st+2nd+3rd+noncoding. All positions containing gaps and missing data were eliminated. There was a total of 257 positions in the final dataset.
Genotyping of Blastocystis species in hemodialysis patients from Makkah, Saudi Arabia
Primer Sequence (5’–3’) Target Blastocystis subtype Specificity Annealing temperature (°C) Product size (bp)
18S rRNAF ACTGCGAATGGCTCATTATAT All 18S rRNA 54 385
18S rRNAR GCATTGTGATTTATTGTCACTACC All 18S rRNA 54 385
Variable Hemodialysis patients (n=100) Normal control (n=50) P-value
Age (yr) 51.57± 10.5 39.66+11.9 -
Sex Male 55 34 0.127
Female 45 16
Abdominal pain Yes 62 20 0.010
No 38 30
Nausea Yes 47 17 0.130
No 53 33
Vomiting Yes 29 4 0.003
No 71 46
Diarrhoea Yes 42 11 0.016
No 58 39
Hemodialysis patients Normal control
Female (n=45) Male (n=55) Total (n=100) Female (n=16) Male (n=34) Total (n=50)
Positive 13 21 34 7 10 17
Negative 32 34 66 9 24 33
N P κ Agreement
Direct smears Ritchie technique N TN103 FN14 0.764 Substantial
P FP0 TP33
Real-time PCR N TN97 FN5 0.831 Perfect
P FP6 TP42
Ritchie technique Direct smears N TN103 FN0 0.764 Substantial
P FP14 TP33
Real-time PCR N TN99 FN3 0.649 Substantial
P FP18 TP30
Real-time PCR Direct smears N TN97 FN6 0.831 Perfect
P FP5 TP42
Ritchie technique N TN99 FN18 0.649 Substantial
P FP3 TP30
Variable Positive (n=34) Negative (n=66) P-value
Sex Male 21 34 0.329
Female 13 32
Abdominal pain Yes 22 40 0.689
No 12 26
Nausea Yes 17 30 0.666
No 17 36
Vomiting Yes 10 19 0.948
No 24 47
Diarrhoea Yes 15 27 0.758
No 19 39
Table 1. PCR primers specific for 18S rRNA gene of Blastocystis hominis
Table 2. Demographic and gastrointestinal characteristics of the study group

Values are presented as mean±SD or number.

Table 3. Blastocystis infection among hemodialysis cases and healthy controls according to sex

Values are presented as number.

Table 4. Agreement between techniques used to detect Blastocystis hominis, in relation to direct smears, Ritchie technique, and real-time PCR

N, negative; P, positive; κ, kappa coefficient; TN, true negative; FN, false negative; FP, false positive; TP, true positive.

Table 5. Sex and clinical characters of hemodialysis patients

Values are presented as number.