Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Mini-Review

Genetic Characteristics of Polymorphic Antigenic Markers among Korean Isolates of Plasmodium vivax

The Korean Journal of Parasitology 2009;47(Suppl):S51-S58.
Published online: October 26, 2009

1Department of Parasitology, Inje University College of Medicine, Busan 614-735, Korea.

2Department of Malariology, Paik Institute for Clinical Research, Inje University, Busan 614-735, Korea.

3Mitochondrial Research Group, Frontier Inje Research for Science and Technology, Inje University, Busan 614-735, Korea.

Corresponding author (wgkho@inje.ac.kr)
• Received: August 6, 2009   • Revised: September 28, 2009   • Accepted: September 28, 2009

Copyright © 2009 by The Korean Society for Parasitology

  • 13,948 Views
  • 81 Download
  • 10 Crossref
  • 12 Scopus

Citations

Citations to this article as recorded by  Crossref logo
  • Alternative Invasion Mechanisms and Host Immune Response to Plasmodium vivax Malaria: Trends and Future Directions
    Daniel Kepple, Kareen Pestana, Junya Tomida, Abnet Abebe, Lemu Golassa, Eugenia Lo
    Microorganisms.2020; 9(1): 15.     CrossRef
  • Identification of an Immunogenic Broadly Inhibitory Surface Epitope of the Plasmodium vivax Duffy Binding Protein Ligand Domain
    Miriam T. George, Jesse L. Schloegel, Francis B. Ntumngia, Samantha J. Barnes, Christopher L. King, Joanne L. Casey, Michael Foley, John H. Adams, Photini Sinnis
    mSphere.2019;[Epub]     CrossRef
  • Genetic Diversity of Plasmodium vivax Causing Epidemic Malaria in the Republic of Korea
    Young Yil Bahk, Jeonga Kim, Seong Kyu Ahn, Byoung-Kuk Na, Jong-Yil Chai, Tong-Soo Kim
    The Korean Journal of Parasitology.2018; 56(6): 545.     CrossRef
  • Genetic diversity and effect of natural selection at apical membrane antigen-1 (AMA-1) among Iranian Plasmodium vivax isolates
    Ahmad Reza Esmaeili Rastaghi, Fatemeh Nedaei, Hossein Nahrevanian, Nazanin Hoseinkhan
    Folia Parasitologica.2014; 61(5): 385.     CrossRef
  • The association of Duffy binding protein region II polymorphisms and its antigenicity in Plasmodium vivax isolates from Thailand
    Patchanee Chootong, Amy M. McHenry, Francis B. Ntumngia, Jetsumon Sattabongkot, John H. Adams
    Parasitology International.2014; 63(6): 858.     CrossRef
  • First imported relapse case of Plasmodium vivax malaria and analysis of its origin by CSP sequencing in Henan Province, China
    Ying Liu, Hong-wei Zhang, Rui-min Zhou, Cheng-yun Yang, Dan Qian, Yu-ling Zhao, Bian-li Xu
    Malaria Journal.2014;[Epub]     CrossRef
  • Microsatellite DNA Analysis Revealed a Drastic Genetic Change of Plasmodium vivax Population in the Republic of Korea During 2002 and 2003
    Moritoshi Iwagami, Seung-Young Hwang, So-Hee Kim, So-Jung Park, Ga-Young Lee, Emilie Louise Akiko Matsumoto-Takahashi, Weon-Gyu Kho, Shigeyuki Kano, Shan Lv
    PLoS Neglected Tropical Diseases.2013; 7(10): e2522.     CrossRef
  • Population Structure and Transmission Dynamics of Plasmodium vivax in the Republic of Korea Based on Microsatellite DNA Analysis
    Moritoshi Iwagami, Megumi Fukumoto, Seung-Young Hwang, So-Hee Kim, Weon-Gyu Kho, Shigeyuki Kano, Mehmet Ali Ozcel
    PLoS Neglected Tropical Diseases.2012; 6(4): e1592.     CrossRef
  • Plasmodium vivax populations revisited: mitochondrial genomes of temperate strains in Asia suggest ancient population expansion
    Miao Miao, Zhaoqing Yang, Harland Patch, Yaming Huang, Ananias A Escalante, Liwang Cui
    BMC Evolutionary Biology.2012;[Epub]     CrossRef
  • Geographical origin of Plasmodium vivax in the Republic of Korea: haplotype network analysis based on the parasite's mitochondrial genome
    Moritoshi Iwagami, Seung-Young Hwang, Megumi Fukumoto, Toshiyuki Hayakawa, Kazuyuki Tanabe, So-Hee Kim, Weon-Gyu Kho, Shigeyuki Kano
    Malaria Journal.2010;[Epub]     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Genetic Characteristics of Polymorphic Antigenic Markers among Korean Isolates of Plasmodium vivax
Korean J Parasitol. 2009;47(Suppl):S51  Published online October 26, 2009
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Genetic Characteristics of Polymorphic Antigenic Markers among Korean Isolates of Plasmodium vivax
Korean J Parasitol. 2009;47(Suppl):S51  Published online October 26, 2009
Close
Genetic Characteristics of Polymorphic Antigenic Markers among Korean Isolates of Plasmodium vivax
Genetic Characteristics of Polymorphic Antigenic Markers among Korean Isolates of Plasmodium vivax
Gene Allele Sequences analysis in polymorphic regions of each gene Reference PvCSP Pre-repeat region Number of repeat motive Post-repeat region Belem KKAEPKNPRENKLKQF GVGDRAD/AGQPA X 20 GGNAANKKAEDA GGNA X 2 * [12] SKA*(KPVCSP96-6)** . . . . . . . . . . . . . . . . . X 18 . . . . . . . . . . . . . . X 3 **[13] SKB*(KPVCSP96-11)** . . . . . . . . . . . . . . . . . X 20 . . . . . . . . . . . . . . X 2 **[14] Sal-1 . . . . . . . . . . . . . . . . . X 20 . . . . . . . . . . . . . . PvMSP-1 Region between ICB4 and ICB5 391 394 401 414 489 526 529 607 619 651 656 Belem FTDA IIPESTKSAGTPGK LKETY KELEE DEFKTK LTVEN VEGQV YVPKVYNTG SKA . .N . .V . . . .SASS .T . . . .Q . . . .Y . . .D. . K . . . . . . . . L . . . I . . . .K . . [16] SKB . .N . .V . . . .SASS .T . . . .Q . . . .Y . . .D. . K . . . . . . . . L . . . I . . . .K . . Sal-1 . . . . . . . . . . . . . . . . . . . . . . . . . .Y . . . . I . . . . L . . . I . . . .K . S PvMSP-1 Region between ICB5 and ICB6    Pre-poly Q repeat region Number of poly Q repeat Belem AKPAASAPVTSGQL LRGSSEAATEVTTNAVTSEDQQQ X 10 [15] South Korea N . . TVAAADIVAKGQS LRGASE .GT.G .T . NAQTAVV X 4-10 Sal-1 N . . TVAAADIVAKGQS LRGASE .GT.G .T . NAQTAVV PvMSP-3     Coiled-coil heptad repeat region Belem Type I (SKOR-67) [17] Type II (SKOR-69) Chesson PvDBP Region II (cysteine rich region) Region III-IV 40 53 59 Belem YSEVV TGKNAQQR AGTGATAGCGATGGACCTGCGGAA- - - - - - - - - - - - - - - - - - - - - - - - - - - TCAATGGC SK-1*(P97-11)**  . . K . . . DEK . . . . . AGTGATAGCGATGGACCTGCGGAA- - - - - - - - - - - - - - - - - - - - - - - - - - - TCAATGGC * [20] SK-2*(P97-14)**  . . . . . . . EK . . . . H AGTGAT- - - - - - GGACCTGCGGAATTTGCAGAATCTACGAAATCTGCGGAATCAATGGC **[21] Sal-1  . . K . . . DEK . . . . . AGTGATAGCGATGGACCTGCGGAA- - - - - - - - - - - - - - - - - - - - - - - - - - - TCAATGGC PvAMA-1 107 112 132 141 145 189 Belem SAYSFLKPV NANDH LENLKAR EKEKT SKOR type l*(SKA)** . . . . . . T . . . . D . . . . . . . . . . .K . . * [18] SKOR type II*(SKG)** . . . . . . T . . . . D . . . . . . . . . . . . . . **[19] Sal-1 . D. . . .R . . . A . . . E. . . . . . PvGAM-1 33-bp repeat [22] Belem TCCATTCGGGTGGGGACGTCGGCGGTGGGGGGG X 4 SK X 4 Chesson X 3
Table 1. Genetic characteristics of alleles found in South Korean isolates

The letters indicate the polymorphic variation sites. The dots and dashes represent identical residues and deletions, respectively.