Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Mini-Review

Molecular Phylogeny of Acanthamoeba

The Korean Journal of Parasitology 2009;47(Suppl):S21-S28.
Published online: October 26, 2009

Department of Parasitology, Kyungpook National University School of Medicine, Daegu 700-422, Korea.JFIFddDuckydqhttp://ns.adobe.com/xap/1.0/ Adobed     ! 1AQa"q 2#w8B36v7XRr$9bCt%u&Ws'(xy4T5fH  !1AQaq"2B Rbr#u67Ѳ3sTt5v8Sc$4ĂCÔ%UӅFV ?_Aנj- H>>,m*>fzp"TrKkr^r.|_&]|*vPuܶvoQ1mwVJUhu-I"=LniAƕ8"۲ k*ҿ[yu:.vUQ+)%F DHyVBk>Hy8jݹ q~9D4KRmzQ)^ʔ.J%k_tVi5NTjg!'ky|5asOȻ)R۸ߩFMԿ3L4j6dڜ#NIwUF]JqB/(FafJRzq3\G՛ ?~\ 6)6W4m[O^L0E&rRMض*C .]Unl-1 1r#Rj/&QɈ׉˩s6Rj=5Tg.y.·Pӡ:JJS:C8-2u]d&vUz;7p9 5VnL֢"y)">iי(IDDd| Yj0; LRfS:ktYK%*N2^m|&dğth":ey)uPQZW)gcC3Pv&MMWd&Ŵ۲mvTRoժM03*F3Yd6\8,\hݻ kߔi<k NTwSԪmljj[>->ptU%'LR>&EBH$MQAUx[$Z6vi&_a.KIQ{hyƒ j"JOC9eFҝfj;˚Ω<[3_m% lQ@4g=5$(J]Yc-OMq<Ǎ wSzڗ)k$7VIP붾ͯnV+卵*t]iЎD31~SA1éC2u)ʼnQn-Uoi3:grI8ؓWm*G zܕ)ZקJ}Y YlGeJ6cB2I NS3Q>k=KTBT]W6+SOXQgGR? telˊ%-Re\hѯ2TF"C/OJΩ6r[N.0{SpljjX1“jOsӥ;ҭhe}xu`Ք&.)yO̒ Fߑ.$Qw;9Iw2o+RVJMSOj[SoҌZ%;`d$blQ{Ro{Imڌ>3egf\O֝Uzx"䢸g+mv%Gʆ:|V[N'&ס-ޝ'kfE|K,G&˳98Juin/\\Qݿ̋v~Ǩ!rtWU d|E߫R4d}.qPw*Ӭv5YEcn~f5c%MTMkb-F>5JT,})QHg%{("ӔȸWMsYyWNRrkkJr0XドnͫT}r-jj,Ŕʍ\Q2Ri>v$5!]"JB2WɅ)]VԜUc8i|.jeRO6^V.¸ Q&#|ܶ-*uOG%JAtRZRr]FFG\۩w+?'zչSѧt jz>KW&ot{7P&2D;&\\>Q2JzܗAKSfeNn[jRrԕf6,q,F1tRfԗ>vֶևj-&R'Zi2=xv~Elbsvm8=ӛ"ū񕜈BȩlWau[]ٷBߨF~J!|Ipr3R̴#Yp)={7:G{+:\W}n|Q#%)7^-h"Ƒq:M*%J&$T軨I333׎g_- ucBwwjp[6i25$̏bU’ٱRv?G\~#Iͪb7<<}Ezt" q_Inw,7-d,G÷%T* Wg1"䥱kq/A.,_KhqŒxwvo u2ۥۧ.bQ}XκA$֣ +K״ZUNmڸII{.v{5z5ѮRme[moyƾd~cRݾK'j.\i&/S6f|b=5: p!6i_ 4j6=.si˧eƾtS^c.Y^RJVS-Vi3,esi08?H$GvZgg?gi䤟2adw릿:"۪lkSN>q-4kI܋ێe̊qۅgDoѨ9; #T.Q;7#~_Ufstb_'w~Xw1Xk,vcOt._}v}8"(4Z\ۘgk?J?bm_c!g{HZV]Fkk%~gEt)b秴vΰB|꽸}mp~E6ݹv;7P٤v+ri*3Ԣ|'O14_~7nP{7ZU\Vű[ +7󖱅o#:ǥŬ\|3r%TJX]V7ez¨Y]lc|O3V! R zbJ'PnGqVJ"19WVeOF埜EaEJωqCN5Z g-9[S<$sUK5b|7sn\7x qmv##FF\ w[=-43$^ooVSiXօv7iB۴yg>]Vf"r$J3""32!Zh[K%7GvNLs+4nB/B{vlsobJaҺJR:0g%&zR\ S3T[&ִor*ⷳc3ʊO[iozW٨%$gn:ܶWwFBԹjHP&z u&F2\f;ipW73 [; '_̽b;vib!oec dC-tS__$Xs]l9&z$2/N>%'[}b{h/{`{Ji׉׏ YJB/X%}.|+{(S:qz]4_Kѵo`^tY_4S#* ^zvݾMr+TrkQ g.8Ͽ^i>ӈǙvix>$o( ^qt*&t1oJVu-ql5U6jCЉmĻ*"?JT=K'O/|=Vo}l0b}}f?X[?/\JSBe,kP8ETJ==?.p5ފgbU9}ǶdNKk—_$8̸͓ۍ8Di\BԿ-1v{FF]|.^ۅ{vl12׏z7-R7wE?\nh\jN/Kձr_oBw"N QMBZqe-m:ӨSn6j4%!hQ;sv'm4kcM=!8\m[M4{SMliۇ%eֽR&N:{2A8)THLK3Zj[jPBx#BگMf:G1\`edcʮ?|w(-̮vXt,bW2;.ιNHRR#YwTM"<;mk\.foIDjmlJ;vxy7o7i\,KQŊ9d^Mmgc L*.T6tLeIuOH3SJQ3=F/ʿ<9\JM6mN6=<{xkP!F1QR[I$6ُimXu2An2yԒMU q f[IB-'䤯jYm52&JG\zд\~vdg QtHGXw&1Lw+nDEdC1w|YJmvP)HZ>i0BPβә?R:QO["]I_Jʏۍ>QKyu^bycBq4lXF~l [\*N>-J6,Gq(Zr5h]CwYӤU~ʶߑ u*SIv%ZfJ7)! FS*s_\|IŸZ)J ]ܜi4"z[+Z,MOZ))}|Ʀ(RUNIII.S'ˍO~˨rn}M)xxӕ0 eyҵ7YMAB]ӣU:/ѭ*6bcwP͵ "+qēVjŹO|GtY4V j[mLV M -m>",B$ GD1~j6O4|LxnNmqATNR3ε|DŽa[fmn-ڭ+FiK7Pcm;r5 l8r{#-]'nrFh2ruycb;pW=njRqRJ(d mnpckNnʹ+6]tz~E=ʕ l ZZ5jSi3#47.Lcfe`9؏v囜.F\-UZ:*0_<Νu9Lӵm&)_3\^ҹ3"1n1v_|uRʞͫr'iȧN_kH׺8xXrj=\МH)V\ˬ.Xʸ oVRC}ySU9/OBY먌5 ٿwޞ)rw8Ӫi5*5ZΗcGƱ !ZۄlmpjJ -l <R̵/JAպZuq\IdUS 48wXJJtcg4cI~aqߓwŷrm-v)G7yS^7H^-\mŌAq|"m9IBnF㏉9[N+mmy/!KKۉ%n +BdddfFF6FQRN-U5;Sv'm4kcM=Mn)\qιqUd9F%",6MGdT%-+~ f%+y֛^3SrF>6lc(֪vۊN;g._0Sѧ]ETWرkQKzGe9ʨsKA"yC y2\[5 rԭ7Gk5Mzw_4sM3hxЊ'oÍ5jsub )ͪ~tR2H]R͍>̋m6=%(˿(Wrr-܅y5(ܔJ޺YunW̹븹NsqK ]/QR#"ZMDfD|43Qw|._ԡSqTZBg??O Ϥ)/E_U|i}2 9Z?¹0:x'3,whǣ?C y-A~=daJј&M?D1_PS+Oi&;a @;Dž7[ zZC"bv:jjMQk$M RԸ3uA\=wI.AwC"^.{?-\NSiˏ"b}T/}q/ o.1M}R%:-ZniʒL$SgrBW*,Mw'N\ɇ{s\j]VryG'8f`}'N<*/`U숻z CwHq18J+vԕKss4R53/&XTt1bZƟo\=%nO)h$rBi-nKĪ^ ջڜlwkYm[̑+/QrZo%TQ;TLs($2C:s.%+eoNttq۰kK7O0m_t_pZ1SsSM7"mevFZ[w -FJ*T*jФQRg BSu|]g:ɵzjqwmltL.e3sRMچkSmjkmWœިm++¦'tILk*բQ D,PB\lI[9{%Gb R6öۍmX-MaʉA931cs..G4CujQտ[9 }G-xwl)IQz j Ó"rqe&=]꾧֎c)<kӳ+0JrRR3'TnXi^xMF Bު*tIL.[h"2"nKzZe'ZV/RrNYz]8죝n]Ķܩ>^Ժ]u-7^\mZjܣ9+Rmn ߑv?oꋘ?&ƪy^N4o=3-ؔ̿*`}V݁ ƒPu8%$ ݗ]wt;\y\>='OjPIp/nJU8{϶FNMsf"ίNqƹ(+ ݮF2Km |jܴZs%zf*eȫ?]4)I۵nR&FX + [jDh(#哑9q9Eծj8noǕZf\J-l&Z˫}`ӎhyrΉn\űn]9pʌӣ"׮Wt?N4_I_~54#/my1Xr*척aS#DT >q ssΛW;3oUaJSRMDgQnt:Ql,/ ܷfRqiM Ȼ>Cob;A>ڦWقM9X~/!'MW.}Vrߔꔵ!5|iB(0-zF=}okڢE$^wW~nokY߮\6՜̌{i-AF*9)\t9IV6۸5ZUF6R$ŨQIq砳YUZ]eyv >hI櫥N )&l JulwE1GDOuFN2| }馥uC1rޫV+^gdb&W[4<^e4YW,d|htͮsUM)۸8:{3d{AѢ)~ \#J=NdƮꮓ90 |1K$v*?мS ]i$J,C,SG?/_՜pMSƯM|mG1V1$~K>CSvkuj=&) -,yLjuFHK{c駗.SOua;BrSqj-ۍZ#'Jys7[g2z/.u4+XV2VQ.ޕ)$"(%)#Z7suZ%j }BǬݕe)Jvz8zJf:hIN|svO1O#IEcۍjݽ:SdὮvu^@:o^5cs>i/VqmVm]ؔܢn6'vޑ̗J4Wn@OlKbX ;n:hgJ9ŻyǑz8f܌q&Y fN0N;[69 rbׅC2/#kE l&2~èMR.*%g=Ft.%؝e8<.e=Uv{~㻏"EˑnvDѭ͜Lu3u0:U֝$[M5<:oi+V4V9 6nXvx&_ q Qqw3W:uϔ2yb/(ɳ|5zQiJ#r|Hw#.W?4aDŲ\ugWG;Cw鐢K|xg)##=O.dF˟jMUvWĻsr.z]kPc9"]R)mkfOd*uYf١RsB Aîh=k]ʳUrrZsq`d#r$/Ը3o^&lRWȍyuW̦Y4QDUMJ65ƒ[+ygk XK_±k#y:8(TJOSQhJt2.DR}"5[) r)6V6u5k:eXZmv𭤔!푊Q[qQ}ҹLE- 8qIZG|UM4j}Mܕ[Vwm{} Naqµ"ԈM zOpKѰ?IAD3Ir0'/q1itoB5{%wkOBn-ۜduqIzYK60{+DʕܞqIt";r1mG/\/ym[6JƫR \L=S=OT@Ix[TMm{>ݾտ֒ݸӉLYIx>+"JVNzx||5rI?C{oz8۹e\R-^\A2F R+N9 vlT]"ۭ d)t֞i #E2jB@׵=#/N+!ĕhx}I!cM`ąZ*ŻɄҒ߮Y.Z}='/oۙ3IpW̮hT7cTSuz9>B}΄&h!>lӵn~j˅IvU.'v'CSZw8QK3G> ,J59ٷ+HSg䧎hJdzvwv-cvxS5[̊n~ؿ%ַX?O0\6ne 6kn9.ϯ} *h 8_QhLݣ7q +=XBҲ5?[[)+F`=4 }B,sNg==u*Nj9k_GJ)+R~GSPBȒZ:(K]heL=vKPӢwq(NrG^ثϣ?#tC?.ͼ[ۅo؞y#%ǛjVyLSw%T*s92JTM%"YkQО.q)gCͲn8cgi6j1MѾ[{9h^vƘǚםidfi.^RHmg&rׇz:}݃}xT$ضk'5s-狶,\vpbPD،=Okf.c#cdz2FK5T!&)|ntD<+OŹU i-G[EE*FDfeaf2QƤM\UG_{ǹm%\yrGy:.\4wjPGUJޕUV7Do\7Vy_13w;[?c]H\$IJ,*L]3b%L{y.JRKG2sq,B6T}(#nW|km+q5] r㪍bJ@y{byz,b踊3ϻJ,'^xd،)JVw#.Vټc''ÝպWtbRؒJz۠8!o9IۄS95E9ؔ-e9JR{dmnッ<[~n${~Њ$W?&ՐY_? #a.ߑv?oꋘ?&ơ|y^N4o=3t=~7!/M3>n8W홎2M`Qx+ z qy8%]7_~540ۦ彷]Wq CѡwkďyF5Dum_}~P(5.(X,K9vᯐ?leB9;Jhm#3{CxGE-S{;@Fz˙]=O'!ɿ]' r`:7'2bЖ>Iy,/eTy/V<.H?UYY{\^#ѣr9^7?xoRȆ7EoS_&??zϾM?(~Q-K&>"~aߨ t7Emsϛ+?;fCr)fY+>z$tIkjn_>vnrֳki-˹l= t;'EyC¥|/BLwBJdgjۛ$s S1|ɍV%JI6KvəhzIlBYɒ|0"Sy0F>eo5W)O+X˻u';v)2vVq۳kۮws?UʑBǴYO漪e2MIjPAک\b1)DDؚKm6ZWΨgȕ۶yjڳ 2ضN[C[|r@9Jfo<_eI7q.|cÊV߷:i.:$ȋ)1%%)ADZCEBxJ0MJۥy(bNsKM9k43IwNt.\%N簤I'.j|ƃ2$grBEٌ\}9:v*!n7M(ɽ]7c@XxƱԨ37īf62cTTfFK]9wntQHͮvٱI/f|j=7}\_V5U^+:uljSȃY(XI.ȱmo1甅jڎIZ2>#\*:gY|4k\8ZwSqtyA!+];бޞKծË¥e)#5ap.QK^8VdU{*ѽL\=qmjnB5>{ Ӟ`v±5 ^k&O~Oshɷ,;6nOW>u6{RqS`)S%jp\ipdEBLfTWy$GIYw~䲭J.1vSY5z.V>^+Ǎvc.I[R{QsNR3ӎfhd>y?UJ*}~[e\i5U^͛E]G_FS(Iɿ]i8:4zj~շsW,ˆsy:%O}iur]iF5~3M:Ӟ#N06)4ߧgdawIotiz:1r5YDZLHBSi;NQc44la=Y kQIT*ըl:tq2(է9VO4뒳܂~2rq'nrVZŦ[t7\oլfb/mlpc.I8콚q^1iE~䰳mi[dۧw֤ICfdFeCsg:i| 6擣׋* 96lust^{%99UNRvaMܽo ammi$em4D6DD\nA%$$#}۷/ݕr99JMն[oT޲E"KTaP+HGkŴj5TM5xƱOS-k`ۛkٝWz;{kS}F;~q|~^_|euwnE'pSupUP)V]vE+t =ZRaVdG6= *.ϼnj9:UɷbېmF_tޫgHjVS'śǕًdkkѻ_]Kv?nT>)^e=Ar1'3ԔILyD?:-^in):{7.؂\.:V }#뺾.3r̸*xbFM aȵz 6SQ:ײj[ 8nn iFMw rR"5M5I旘35f^j='j:nNW.ʭocZvZKV^ɚJ.cM1ZI7E'6rg탸5oZ=[m Z`\hbMUR١Ȗĉ):Jin!_7Dй+f̷eKҷvͨBPR(V`y6tw*MRΝcB.ڭTnc;P$8nFvm4(D(R#R-L -2:FP lxZKQc6I("Km%$E, 78uXIFA$RQI$JbInG]c[ֹ:ZM+n^')JmJMJRu{e)7jQDw~%yQl}BZujSSf۩QZ+Dzhd5o%BIc'GZ?}΍:>Ɵivז-%݌J5MqGWTVʦh݇ܟ~Օ_6 n'{3~mϬj'J11OȻn߃r Qr\3y٘+WӍ'WxEs^O3 o~[|7>]]H9݇ZomT@]?5B:Z߂'`V_+/MSKX߆ޠk3?o7y:4R/7þ] iG߬aBRU&?r&/} cQߥGj2?C5Yśe7hU=?+ x龳f-܈czW^7p%-(\D4h{UK&ӡn^m]Fݢ:`δvj俜F+) y[{{ 7 tu>gvrěOj'5 iRg[ͶFjGe n~qT$ci ۚ0oԹc*jL[sVWqj\ݻ&6"WoK:cnWmrv)o>66(F>=W^bf#c zzʞtپy%mՉPël e}J.\Zk4ttt>oEM=q)hJjI=ͥ(%]脼_88ф;͛gWG;Cw~˘$4=uWdĜTثNDkiQL9U*O"4XP`02,Ge-k5$h>ܼ]3vr6!9RQPIVSnM(ۓ{>;/Qͱv{3&-[rc)ܚI$n{Sv3[j00)-D3z}MRzVQпj,T[uVs0\}Sid;r(ݝJ>æʺL&c[jPK0~d(FKÝW\m]GTcF|Iׁ)I3~#oX%vҦEݑؼ5Żv2qAZTE^..M{ʐfȏ2##.R}*KʛZz^ӞN*lPťLf\G6[WVQquV]XAi)5J!,$iJ6o$tPZc;Kjx_n3`qIelV~vLy{fn匋Ѿn%;zV.n'-ұdd2߽1bZksPe3TI9)$ԩIN9Vơ\=2885N\ p)/a柛w9g_lױo8ݷ iixJV& ғRi{N^_oAŮE6Y7I$Nk$|Q)-*4Z)^¸%4Qm [I%.c-OV+C֧R#%ѨCe3i;w$G+_dy| Fzj$DI(=OA gj%v/]8qԯNIS*֩',Q%\44ZZ%D|Ǧʴ6&vֵI$%8(ԬƾS&#Z. }6z?b/|Jl{ץv&mpx4Z$”ڝ4-H%dGKfM:sKSRWeJAn]>s6应-W9'H]'uȫYvgK^\czp|My\鏩w/ËQ.)]\QiS`8uL뚛̸=J"ܻi\å'-)54Ue]:K\퓡vK xwBqrH\*֕TnzC.mT=t-H]SČ~Nu╏NÅ3f|͡G~B+Xm[Q7U{9"~jgK Zoʰ7"qJ,ekSeNGgϳ] ^.6:s}_,%eRg<5⿨z{ZPun#jRІ.6g T.!]xa c#jN$Zpl̋H WZu8WmMRýsĮ?Mco~sx TU҆Q :KDG4n42.<3/'^?6/ܠڒ^yrrÿr2\D}}B]^E~^T cɛ7϶Y[<֞[7d}2%QPqOLEQR\CIsj1?\}%tJ0e~ *sk"*)&ۓEi#{1J8Hrt|'ܝRr8)=ƔN'RVz:cf]F7bZyZUȘ4x8,#JG̒?.W9XnO]KO]%]ƻ O5Γ/3qÓj؍/r̺rƵ 5\&m6h.xoeX[=<3%< lZ"2h\Z[&jW3ejm?k&[]ųj+{N{66leu_+lj]q* 7g*knأYv= q ەdxЬZ|%GUrQ3jLŒqET]1% qkXYūYc[7Ś]QY\jko\</Lc7+'hMSUc6qXyؙ~6#ѯv.0$BQi5YyIhɍiy=KD!n3Vm[V%W-B%swa97ajۗ m+9~]fKq|Ddaˑ0A]_v޺mM5* F-BYHJ5}q>ʉ.6hyDmpD׬'-_v5;5[8K[viJ.3dR:oYHHh9I7:۽fi+wm^ [)odPѱ52CZUJicSw\&_s0uBȍh32džzQflcd^m|7GѹE!fO5]]H9݇ZomT@]?5B:Z߂'`V_+/MSKX߆ޠk3?o7y:4R/7þ] iG߬aBRU&?r&/} cQߥGj2?C5Yśe7hU=?+ x龳f-܈czW^7p%5|Y:SJE\U-(a_cƣUǽXXKiȞNlmۊڭڄR!**ܤMeȽ$|X5(Ź\rJ~ܮ]>'HB0cp XFr_c?f?7<ukSgov¥iG>>䙗i.+t+bOjIܶ . i^:nm}s}(3>NZ$2Qg([".>i.ƾ)B̋M8+"- >eE6DݥJnJˣt׻ 5.˅nJGwZD~!i۶a,Db3ZQ3O#KO5/֍ozuK'GbRi᝘NV_ҝcvם ZoX}F6z 7e5_e:ۓj=AB+iܔERadMBq*ԯ DwI/Gy*mĥiRKg6skY/#SN4e$-yXM YL?^ĸNNӪ{$r1JJRSLO]Aqm>V/s[~i/j+m>z}eI"Qvp]{ZԼ:{vPAG2=T͡@ڐ#u"E*>C;o$~C#_d/HBq^YRٽzIKbOm\~żjFFGdiQ(*/i*#.FF]©m=BmpQQQSP&Ҫ!T&^>:y)$ˑÐFčI Bӡ-t!bM WҦŶ'UZ=}zvn~oT/\ǒ'nr8 AJIӆz<^uߖ4eFC1i+v!3qNyߕni?4JZlmYFXFۼO0B\m[ tʄU3s"Sr(NJ;SKW72L4̏BVdf^Ҹj\]ȱ۪(ӷm?J-KEmWڽ^4<8qu%9pŹW~877ܾeVгS(յe^C]yX͹! םm4FGȋ\y'Z FX7e)|Gjt߹#gb\ŧq_([R8[qU$Z (ʻezV2V!iQ,i$JE˂٩ a(GK'O{vnBvryRd-RK4=qxZJMl_CuuIz @Rt㮽޳!|68\-l[џ84-2Pu" RJ_^OL>G1~XnBŬw6J0*Uvlږ1N G1q9IUm*'oWu][&UyYZbBZRZNfEJf"+2nF~Eû7n1xv.RUM$6 lAxSQJ&n5ܞwlEói"#>4׿Q.nEq7Oko[1wg8ZQwZYiqtm&~">Bo?w͡ni2峋NCEy Ҕ+%ZJ ʩq*fpˤl,~^Mχk1+:ݕ z&Y`KLӪУDr3[*Z :(SL&ݻ۬Vqsyԭs x|iI߽zZrg.:mp%6ԜvgmpIUt;QbS.Է) ǨKSV,*lڌ|5Jt3#NP.=+OZ~/G سIgbꥹJnl_DUM\iM!֔wVZuԺ,yV.Q>f v:݇WiaŸN5Ҕ[M7SsrvǣrMW= \8ZW-jsnڕ.ZnF2qt ً[ٻޘY۷Zm"Jxr&NAfA-݌to9s359݆mZ+N1-qS$D=17 x׵+%_ ve4ir6Z$FDڗnFtOr'7'{9C˨ꤡaYoace{Refnft RR"4%ʌm:Sj3)OdInTO>X'vxV#jܮw9Fog;5.~Y5\~18YQܹvj4+~t7S ﬕs %^۵ڴDZV69R^Y+rj$ԇoJKR5wB9C>Y:l+EǎS{ʲ{T6Wi* ^^9k/y/Cs\g*qڵgn4T8mERr|Ti+iPe;;.i\EBEJ 丬i9ɧM-ԼsGDrZ>r#R>~X9y4b棇9JwV۔%m(b[Tjvl}۩~nDԺ{Zo-YuK1vx.nWuO+jN [ٮ0%"΢CdTJK-RަH"$I(*ve &҉FzB,_Vpqp9m8werv')E;o&QE׵^d9˦j\_,ڵugZȻ̧8k+jK{wmr@3ӭ2 wFkzFVqs1؛.v'I%$[iT]D5Dl2 nk7qUxԫLS+sا3/ΖeZYK<["%-g/kRs:f3;*E ت wJ%)5&+&rw*霣i|sMҴ|;R+fm䡩.!**dӶ-6s6,]zAXMWjmnz%SJߴm2UXw7MQ%<!tKys#P,W>s;3IYwx<+i_\\\U6 u7P|xbn_k&ӓVOe䦒 VUr,-㘘"-LZeOSҠթrEvq8Kf%5%&K"#%vD/.ZYYŏ+p$nZkvއuW9㓱Z G wYIFyf)?ƎUm5ԉ/'k84{KO:rQI}XRuԪ|*lu)3qZ[mSm5R3".Xcَ5c®ࢫI*۳~wRϿQWޝ(EJrri&ۥ^ʶ齲Im|[yb;mnm֩uiܘq>E+Ikx߄3r33-5𹻖09ϖ9[Tz~mr5NsWl$oPusޛ^{Z;);sڹf\3oٹZmԉ/'k84{NO:rQIBø8Bݱ3n֤DiK4u& ofSȒܩx<˘|N0Fչ]qsp"}! QWw@t4ӭ+cO5%]'*{eM߲DRO1y*q8w++e!c߶ܪlZWّM欼 CQ̼빶lX{vib/V/ ai;x6~]+z]MWB>re-:lgk}պ!#9?%܋V-c[z!W?c7YNm/jRr[HOzԻefճ0q15Zp#rkQQ0tU-AmڵP/cȕ?0cZYj;:0ZM=D6g ?'UN+ձ[K ܖB2'xq9{|۫N0ku 7xaj;n\ 2[VznMlWiKbSk))f..)Km)&bGZ=>OR܍W:j'rM'wYz&/鶧{Sʵb"vջq[I-ՌZH._x*BagC'T(Q:$ͳQcMCKy?3g'ߝqnT);qs #ؤZ}OOI:cfnc8W~qy.;^pVl]Hԓ>^H^@7-AA܃nmL(uWܻS߿ Td95Bdh4t6*dDh!EhI[iŨ\L.&Nc ܮf^;$R)\rip9I|ٺ?#R.ZDZ;/]nݻqs\QE9M&Bd ]N mN*D>tgbK>+ˏ.!23]BȔR1ɝ^j'k2ƮqBQq[$di]icV/e`޵B.FIIJqbi>Ӥ|p; 6${)RU>_e}^dzdfzi %ekRVUS?6'hׂ)5.\+qUgzE2C˷ecŏ^֔ibk shesFWJ#~> Wk~ݨ}ڶ>ơǚ)׽ZƉo~B-ڼrvoE:Ʃ3ۣK7+Y`WirS):{>ڛ}:wԨ(J_";6R%[u&ƫdZ_\'np| RJwNeTW,=rrbnkڄ[M3ܴz)3- R.?:okۼ0TU'w{6&w7j1z3ON'fGoO?)S_bQ_¿R(^ԴԴG.EtMڇ&RUiW uQjU> Kiu1d<ѥIQ'RQ1:O/lŗᏩiʂv&Jc{D5 Tt)1.n[n۶X}RjqnOʽ(~[Ns{ސ⛌uO,kgo֢dRNQȄ .'6W!׌P朼tdZjFGE"]K@'i۪N;sI[{SOzk>`rRR+!σj8&TjlvA̷Q?HyjyLHNտJMjܶT۽lG?SnKN%<‘ nq[N0Sq[Ta(&t(|HGO~gvkݻTR4&Z$#ViOY1r$6YF?e4U/Mvxų:zbU^gQQ+NW_'4jfz^c'#`rvrڡ(IJ/J ݦ6 ]-CW |_{v*_q3^DZ}Ic6Uڌ8p7{crZq5ki`)mU6|-Z5^iEz3P=:Cu7DF'k%}<C-޹ֲ̱#\,(f88%X-N(ck0VLR~} G"-8ӏ/ϰKq?(#nrVTmZ;zióM4 m |UT'C^_1X.gXM{%ʤd 4\ovN":"y-,T)fLQgۢr=/CƹǨJVr[a+!rT|%Y\ٱzsS>jͱ.oOc6f$q% ǒGo;n[];ߎjrk{~\VۓNIGn:iqxo |~t5)Rxעri{Vi&NUOl_ѮMfsޕkЄay.0P{7N((BaIP$ K"U6Gl ݙqJRu+qN$ m#*p<|{:>-Ev=86N*MM긭U*uѾ?/^o7;'u,h4݌xښRM:5.(/ \իU.{F^rmF-Jɷ.>Q"[4xT^OZ~mK}T0ݛ^SAo9u?lX(' qj%=X}"^e4wˠ|rܫ 6I\Ķ;Ӻw!'ڍWg{ i U_9Avhۣƾ+:vs/MK[ɭīe{`Zgb}r[i'GE2J7Nez579wRq+Un ]J.cJ4M:h箽Wxxm^ pc\wcN%'My $$| :$Fqɏ¾^қP9J6Wxvu}ݵP>Z'FFdg"-; [¢cmWkÎT8nG%ݣ7*\խCLRYZͤiD&J#'ehbSyXK|y*ӞpS̍R`[pTr/Eg)K+92{_ n3zwz'oŸۤ+sOj J:`T>Cf*lwd\fYOP"R E֢̔L4ɥ :;.b(B02rJ蠟9>V'9M%)IqnhP<%,r'P/vNSwr#w"ݨaqc(|{kd=^0jTMR2ULNz|.<|^PfY22##!,K~E BEJۜ&jRNsHަޛg\r,v؜.jK3)[EJ2ii{KEiHP^&]Gn8x=K}Wx/KI9-ϵwQ%spܾ[^R}S3$qvq8M[ ozKxcqmJ/ӿ{_}7&ݨ\f6ZSyQz& 7ۉ[8~UNn|nkiTB+4RI8'Nc%tn{!]Ȋo.nEmʱn𵵥J A+wy#+ikǒڂ;՛s85'KmE:Ђu""Iģ5p=БbTY-ͽڔ詻ngL2Q}$de# fs^o{DUUsfwӶ;s1T,ǤtޒQ\෼J=.tKU,7čJ5 N$y3kdSMQU~mO[03 $zAڟsF5^뜞"Կ QHmrR"ӳηer+ҔZ]hE-6Jmt'ޒ=O[sQj)6K}?e4v_KfZheޓ=BV[bY}lݒTTЬ{ȫvO_qpRApVŗ 6ju=*BR)g "O1yhb=tqJ gtm\b3RY+JQ^Ō֍\յ\>+uSi{=x ^w;uӘ#ĸzLn*$anok߷CBӷ}5Yqvdž<( "_OWit5:EZj2 B ρ1̊fi[n!HQF82q1牙nqnEpT(2RMoM4ϳOu ':֧_Xjsg jP^(ڙ{2%E͖j^}ZU[Q$'U) <܂%!s"m R'G5M0<+zM6qYm$ڕ$3ǧH]?o2N<8F1̻r_my[Rf59NjpzBnl7*{.QP 3N&^BLJPjAHCK2Q}$#~YMq8 k(MFMU)8MEqTy+Tʞ-ar5yܕOXw!e;q-Jqܶ䓊Y:LC UE{/t>r"lI9)3KJjϤA 6SEE$d߇3KG*En|P\ԭTn6I-ƍKTj<1H_zwGr19wF N8ݝ+a9ɫM6mhePi%mmD! """"""*1bRKrD"vnrM۫mmĽm]ӡiG~e"˩ lhRTMk^MX["Jݱk7_ޕ*DqĒ&flՒ}`W}~SմZ{ĕ~wm*/{{ѹ_-0ط#P]xlڱ~Tn5wi*lڪ (JxioϏbqKYR|!|KN53 OS222$jzww%i}>N)E+rۥ7c$Ofl/LNث\6H9: FY󡈾I)fB֔JI_ ֣^: 9mY{66㒢7Uj]:.-os[R&gMF3˸#໹kmjq^8W"PΦURjʄWa˧T!͋ lW48JB2ko+ /Nw QwQzQ ے%$ޓ7^YL|r7!v%Trܥ &|M8~ybrn[RV gSn{{*#2#ԽᢏӴHak" ӌcwҜw&RJ07ױ>Ļ =^ BɆ)v32.M1=#6%̠tҤnzqMwԣ~s*%-j|_m*.Yx9Sz=)qE4 3pk+,`=kNRڥ=B=nŔNAx)Q$ԩȧ4z3t#Z2lҮYn$S%y- JzGpu|LBV7ZW#;Wwipܷ%(6jFG5#{$D"uۭ~]֫SrD܃fҎӾ+Tu>-ZTQ& N|$沸ii>eRWݳu'[O̻j8JۻEѩ[]vni= ڒ,[_%kC7I3Nv$4ɎЈeٸoUu:[}Do5|zNq=Tre%ɧ6&~DȍF]ƞG5q m]/w/ \ʲr8=oʔe9U(W"|S]uZd#?Se[W"ֿh][-7Nu:T=)R}.;ml*5Dlf $fF(̏T hiIUU4Szɕ t(%_|2 ~6eM;TƗK[f&]LK^CE2[ȏBOd;Mi|cx,^6;sیGpQ\NuJIFTJ~đArh* B"$H쉩eXPRj?sl"ԥ)su]xpԴY%VESH"ЋJǰ K&5^Ukzׄ8kEgS2h&Se\ Yl]WҶp-ZUvi7QS:4byqOo+[̺腋[6-_Fo.6[7$p&^ _GZԸߍkc.qqoI[9m߸YxOZЦ1uoiSH)P9Uʄjcq= S>֙NeR><;+ڌk%_qT].srNO?s[=vH[]RZHRMtᩗVؾ:/~u)ԍdg%=edVrISb{6vSu=(ܥ)mTv/J}̇8 S3ad:^hBSf؉OɔLhI_1d8,L><_A0y3rXq"'(۱;mFNII.v5_(^q~X>y{3צ I*Vܛv/jW' T'NR'j%ꔩ:mJ3SB}΋!-H-RJBТQoedi9tjENenPpke.%4]#{:>mkEɱdYWl\\\'nRM4&U>?Ќˉk÷!𴪛]]5}UqG~ݏI"O~s6(Ļ)qO~h}uԕd}Q~G,oE!&G&/]_H-O=o{k\̭bkv.Ô܈+;arZx)m?M\3lU$mk-CFXjTv6u' g:Vn_*qk:VC A%'4JV%EY)#BғO4<e׿jQQ]yUr4=wm[K1r׵%Iũ-O}|kC;/VcݩWZ)EHdžTru]8hgĵ-;=>U_ InvTm_jBM+QiF"9*{DI/iuo(=TzϖmPQl_v4z>T*ȴ>YF;ε\t]EH4ꌇ[VrLzef 2T^V>g2~kg5~Nק;{~Z~W}&ŒBӿS2$J?~(Yœ"˲ߩ\O]: J׉ښT{mmIѩn3˧)4LdFZ/zUG>U> n 5& ϴ-KJi2o]uKljvK3$bԔҚV旧iY5.ίfi96v7!v))FJM4{jG~Jt/lUE%pTAFe4qQk\ve۽/u/Im+W')v{\-E|Pms7߮DZRr۞/mu*1ՙaB܆ -xg3#6ۥtRogʌU)׎]ZҞNnŞr}F1Nnޞ;cZ{N}ۿMiuxʉ*3qi'9KHQ$WJxXyرŔe~[v5~/jN9Q4o6rJv FrdxM*iRjMzUinHdн7ᾞS=S'7 } ̽zt7K|_g J=Lq+/Bw_\ۧx\HJUPzQ<hqF[V0x==CsU7q|^ {)Iq38$_A(VgcKu06Ƅ"%i~_ˉk QCܣB8Ku/񋇵u([w}$F|8TՠI.E !;RJ^}MɒD_q2];Ɖ{5}*n7nEInO{Mwv}&q+v [V}Ĝ@%>#dXQ$f;iep.GquixVt x6bj͵mlKقQ[T]zs/&yەnM'W}!Fp_d^Tu N{ɻ'l{խ2.sTu{W^H&;1s)Pӛ6>$mě;Łnj= fLT)>׸+qReɴ[UR\L*P/!$Ӊ3Q 'K=m~6XqW3^W+ųO_[F$rR*u"T%@O +%# ]˽!aܽz{ͷvQh쩎]hGތ5ɇ*DzJDRNLi 4:{~2FmXY-zzĽ^f=]uū{/+&c:Ma{ĝDp2m܍kHș/(--m_vݮK(V{R}.k&yƴ7i^4@3f sK3^Ř˸B=]?gt5KbZB<e;kQLpxuWC}n 5ҴepB##~q= `x]KWF {GfŲ}?G.I9pjWkU]>={7q{kO/^I3==f1ɏ%nnʫ/Zu_yXN<57ۍ'vy/"8넭M2eԷ&Y,в33%IkjMr7xf nmQkX4踼>a-GcIeތw&U=-:qnW)z¥j :WqSZvԒ#j"KrIU)%qrmRoDGQ~SYRsu*V)  ,/x)MFD6O#]z 96[Ui(JRfw'y$GeUީkdMF-ݻ98F2d[o{Rn0n-xsV6Dh|Eb2E:KCOӪv4SJCr"J!!m,hRLD| ZYFm/X~ΧfrN&4Ƒ=Z9Mh.Mܵw/BdrܥniŪ8ɧ|y%œ[M=_tj?F!z5\evM:\ ~F-sg钬OWq“iiȍ<Gi%%n2rqͻllƑ)okw7}\Uk-:&fj솘XerV9yZuʼşdFC=rmo%~ZN78X(N)_7.Εn1MpJ}62jjJdI";R5&iLԸc:jmqiQj$ujp\{;v5B񥍪Xn Ą4qOERjzN(Ga٠䌡)p*v(J7#ZۻZ8O W uONb+^Qipv9GvֽƼϯrYƖKGJQDNPhRJjᡧC"21"9ѓS1;R_O7/WGz)8fE%F2ukmvSov/iZ&/]~KmI[:^~ͤ\kMi稜\ywJt3W7 8Ʒ~ݥeFgѼw"8VVSج\뻆}ݭ/J6Q)d|)zU3>k\L=;ow֯gN3pKѫ|wmkZ$z^2R:E)f>ς нd|#׆?\ǔpV{;\$ƵE%-ͪm0S6[n< kE[}mvE4DDZ^$OZ0*$~XUv҅B@^?]so#%ojw;Y#SxxueBگy v^i-)s)zV jC{7Gt.w3v,ygg8s]aE_,*E tY5k٨h=o"m泏:\6w噓aiL׎n^c\75AGkЯ0Lf46َ`egZ˓p/k;̛]kq!ݸzpԭG"}R9Ve>ˏHUjJ-&7nrnwG*Xv\˱/vN}O)ʼn&CV͍f̵]r\PMB-6Du-#RͰtRN^)mT _}nSȕC*_xBuTkJW[`ɩ`ejvsngP ڻ.-WUtܑqԹQj)t;vN&RNũT+8%IXӃ5fK՛-d9 ]CƑm|nZ-6=Hz,*aEm W3VzRšdY~Xf׀Xx"]s;)5u*ُHB BRGS6bݶؿ 9j[1*jױga7oX CUI%0v#~\-O-Ꙛuɷ쏪&5mY٦M`LJ2qK~HZbr =N'YobI. (^ ׾{_ ?OJ`S`3BN[}5w6:ǵ/iSlt=4F*d&T4y/#. ɵim5Uֲf 眕6Y7 fơ=3dϕq뚩$qTM-%r!$@A? ޾V0c~{[{;򥧅a~ڵ»&ڄv1ek=wb MLkNAԬw-x>~/r=e73VeVN)K%Sښe"+3uXuچrn ֺVzscJ峻m}vb㶓n\YbIUBT%*,0nov=;z꣓S/nSXSpl##k9mXGrZv^Gde!ŷRԠzQyjC]`gToPov{j~KRBMY}i[߶9KL2ԉO0K#m>wB[ٍ+n[[b٦DX ݲpo] [\m5qdT()mo4Oy9Ie b][wղmM~vmi۱~t \}$яimRk(L c Cvk7r9_r1 ;zv|F@KyZ[&jEji/"6$69ml#e]9s\{ScL}Ȣؿ0q/nZ*t,CLoD߉Njǚy=Pgmu6^]l-["çUʖMlʍp-"qmU>۷uFOJ%Ǔkx 'g=睋k[3u,{³WɘݪF]ՍeFX"Oy\,cچ=w/gn Ļ]#2? vqy-gXnR.^}ݺFs{ŝG]}e|#0mjx"ƬWكm?rgU^xVB":Dt>@LRbun~ݭ,w+v⪕;\U(RYa61>#Jm˞Μ9g9XKaG='u8gf}'qy#ɉw J]We.ʲ-<+&q%s?2dњztҼn`cΤmmqMdz O[-ߩӲ&;[tmܝVnr">{x<8U+p:Ig]zjGkt,uzf}dؠoJaکqEq -(:d<պ=eKy[˗^%ZXkX[C2߱\ITTLGzANM￵i]K>UsOGDDD.ZF6* ҃V Zhz{'xp^`wo8r0h ZmJ5"jb[l=yUu7-;7IT%:jFjߖm0tzU'K)څNۧYJ)4IQ}^KWm7kSP>q;ނ#)'n7&׊r?óM{IwR\j2Qn[v pe#/tAF\ϵ225q֒om6z})6҅*oqDsMf CNIN=T S2t,_ѧ}kveMF0J\Rnnݙܹy[rUc-j{yGtkQ%s]5qB.Nw.JN1LvR Ui5J ZESQԙr):MJ+g}χ!2;q([jAud][ljVK3$ײSJI=/|&tl'*n۽f.frܥ jQO8>&Z];.|7T/C}$ڋUmP2Reҭ8hFF\L 3~e v\۫]ݝNmrnB%*]Z«hKc=BTLG :V74$=Ǘy+EX'4tn(I:Ѝ;Df8c,k1%dJ6.j6ź{N~l6&*fœI7 WAlGOu-ҢH,,(ǔe뿋쩨kM܍ZſgRvQ' 9)?n|er˭|I|-fGK.rΛp8XV1%K6mvG+tc+qE&ǸC_Nm:l=_/m5^[dߌڇ.c<%:)tQ$Ow~-aY;UJ>=F)2[nk؆?훐M=l6[4(O.]2#-H^n#->&mp5~Fӛ+|| S,xag%qkEUzUgæBhߕP(7]kFnq?֖CpruZ6*rEڊtS|*tI*E}7R<,nUU֫^I7Q*mSly%rdȓd8hE<9oHhMfNSRj[i7D[Rj݊+kდq{"$$H?p\̅S?㭻;t~R߁)^/>Qj`yt[w ԛ;²~+ߔ_ YW~|o]?x^ᯛ `ʼn;g)T@vWn]>&4lp+$D̢1l|ȨF%-}.9[}w~ ԠLM9hСablfe&QoW!s?wjLK?s7yO>(=C~_nyǜu?v3vyo oI@qV-jeES^[9WoSܝh"l2C1a͔CiJ@3:Pճw=/7ovuk+\V;lDgն<[A+rX~d;m!_s8ݖ׷;;.0llUC+?i#_crʙ1~C.\–q ul8Hܶ2m`ܻM3Tov|Bs rɵ"oLS- DКw=Tv@f'6|YlD͓Y%׵-#Ѯo%:&!3o%\J<02;K87>^vgƓ# ;ݝmz^Y6=PS39U%~ &f# }o!muH;ʲŇ˷yvP+&.7e[3'vR4Yj̗IZ`e˽3o[WU{ m[sUbۋZǾۆl6~9'V*.\S2<Sd*zY[aŶ`]C$n.v^Ʌ dng>ەZ,Mmϑ :n6nϦezWqUJ4! ۇ4R! =>>Fn|Q[{pRO17ƕ~._I''00k=b՛o}Osðc2'o\3}ݭQ^2 . R1yKȣtAݿ-uܾw!`?1Whn|gzUo[ECWwjUIן)^h#1ɭ!/Z np;o;ΗŻkXs."6E`Z1 עӐ9Kl8qd q} 2Stt;#j>;խabONŗ=fwP1j)l6J̶|gV2`y/0E˛6+ԫ1? 6}KW c\KoKͨ2ۅFw–s*TԞLיuDx .kCzWXhy۶gLu|%TnupǺl-S* PRaLnT+c+*xl.v!.U=|; !_L̎뱚U=4hm:ٯ"y)$:>%(n}X'p[ȴ ^˒4kƓmzDx \ 'NqamP7nyN݅=j7%McSڵj%STy qXymvCg{w/w=wSW5r̹u erծˊsOm=DhEҚRb#n)QOxtվQwe]I}wCa'"[ۂ-z}2UuKP$㜉ԧ:mc<Ý>RoL?wu|%ҷ&K y_!y9 ??:tq3(UU-lkS'ɸ@jdzQˬR] EVPW1DJq2n:,c|ǻ̑;y{X,ۂ.u.b˕u.tKBjQ"[S園S`ٮdNبeJ&9Ơ ~0a(Vm٘L+Jr*vڑE( x0+tp˕ n';wm-ޜMOxX>{#2%jgb2M[`K*\5@8l'e=0u+w ֘鳾{y܀:R*Ya]"Ӧ%ktynlۣ65,3gU}{GYrb;ge'TKwǘ.,rpܚV]Tr,!dp /ԺU,xՉ>s׽~W5oTh yx?xrrx?)?ilbT׬,z$Ԏ.UH٠\U1pU:]JwSrGZq8àd驐,N67QYBӢD㏙W!Q25ϸo9ms-7-%3CihO.J鯽-;MZM8ku-7k9S$8]q2E(}bۏI[DKOK}3KUB^u %Y,u.-&f#]'܆o$x`Yu,dzwM;#oKxn;\[d7}Rb+*Y䛂ZuBӱl{j0O̓}LhK;[aֶaGL{Cb#S.T[>߃F]NK"u^LUʐ_ykW?!GRj29͖qa'0[npcDvV)qz9R)PۨM^aJx W] r>];eN3vxdmĘ(5W2K1䪖weF{mE/QP6\u54x5[hۮ-Nk”i[lUgL]J}5 S:EhiUrgHl!ŒJ$pe=q^b͵Q' ?6|R\,JA ڵ"TDꈭ:ymg`B5t%M] <N_zv2_Ortٵ/i/ReӮ*7[qүqEG* m"[I:6e^p"I$jԴęh!m)]GZkcjS!{e^z}+Cѥ9;R|/ֱeiUԏCNu2Zhcٗg$ݭwvr P8*7/Lk~I'Km1+MW%Bk|oOm>-#qj*|Dbѱkn|n{v#jĮqNpMIUm(7Liz;{ҜݞڝVƚVϬ+sO!OstGvxӉ']uӎ4g_ 1^-8ۦ k!)Ύ5O;YSB#2Zzχ;<.ֵOtge~.(RC#wFZeGZٸ6FFJ4e2ˇpJT$[wgV)q6muDGJ56q\I!̗ y/I~RtJ9kJ]Iy*'FN0s.[l!fw'y(7$œ WƫgyΙdMEU JQJv̋vmrۖ.jWR_M֨djYgSj0^\y'EoECjm$ IƩK>Z28J2TiJ2N#}.s cArl嫶nB.FIJ.)۔\ZiM>/hLĸ=C1s[?YMqp|94- 鮝𦔽/k^#NT(Y LS$6˩}{;5 )B۷W$qpN)qqoot}ZDVә;7TiK|6f3h$dԄ}fqݡ>Nb򗉉+ͶO]>ߡ_VtYf79ڰիF sq~prս|QM)g%l0ocJȨHz V;Bb/kLAcfPJ,ԭ{ƍgpjNR6VSI*$!yV足jᇑ.](EܣqM\qJ2eZT).<9UB/(B0j)mtKEj#׿fDI-=rZړj|'Nڤ]k*i$5qt"ݙPM6E4ke^Z8ۏhz$Q(R Ay2zfRñnpnkbkI:=j &ΝșW?׵d{+ύM'??XqeeĽ.[o=UxFS=ӷdZwenՄ]_X=ĭVa* pKs0ބۍfJ3 gz̚i|wnxtjc¼5${(1fXQ65ȼb̶Zkn>%FQMJXӡ{TZEVNᖣimT/37cNJUPnP҂ZOE~"-Rc4^b- FEͧtf5[)S!OZIښݲ͑;tvܡ+N)AR=hCNn;wL16-:特7M$=Tҕ-.R[HٷnXk sn[ҞD-0WS9p9:-Ϸ-jѬNu{ҹfv)[Ľvwfg(ٷfe+0mYj8Q1\ݧg]Eǎvڿc!4#j5̋C2"}BRriFp7=ô\TZ:\BLfj#I22װ<;صZl j 6:l"6]۸ K'6RTѯ^ئOԓV\?$x7s#r:Oh{ց=MmuHԷd{pN /܅:UE#Yy+(SgQ(Щ)RHzw>^Ѿݻ>mK&^ '$Jۻ&w%F|xfz%˳ L~3N?Cy9 v w/{ƿ kz3x> sXv}vP"@WyC z`'톽Dw%-tt yVY\wmuPYQA0iG-2JP,6/gˢ]u.-n!Zw.N7Q]Df}Q0({a\@=i_X7gFǘ8^⻲}G MZ1)WEfO12G+=-B@z\`||w6ċj߬m}UwRox֢I &c~XGP6Qndpvܻul'V7^FJt^{b^B(L~sѣ6@߿^xqU!ڙ5|Vpvef-uӥ^3  FSDɯKD%0r}FF穛r7 +o"V8tv̖NQU!5uFd"bCr^bJ=֤fM#ʳԷP0O-9xRBm\=`r-:;~3Tl(nXtXi%2Vٛ#vwqƴ`L@"H‹qW.j,JM5B[)WܺUeZFqc'V˷1W7V̾-MHФwn8N;HPSdݷC7&2j.W\τGŎ'Vb]c.x+Rx1%C2T{myg[qU|+m:M:շ8҉yWd)ՋWS%%:iqlʹmGwݹ WnNŤѩ5(9hTٵDdGUi-)vSs2 2{OnT$Xck n:¶(lASLeȔBjμPpTb2~N2~%^k[ܗ[Jzs0ӓHBKq[}JَA-$dFQgjxxFv4r/x*Rm% `4J(&iv7SkԲmSH1YWmx 8n.k']:Z˭_W >ڃXЩ. jTq%Aā[E}amc]D:rmHRiu:uӚӢ\p(5-q%e)(۬ҖȽIf<߽pr&ݫVfY91q2ĭEQgYbTGQ&,yL+N$[q*RVۉQ=FuTܻ>f>f㋳8N6$܌n)9&»iˤsX,݅܍ȩv+sRTpO}d?Wn/Inpȸ%O]StQO|v5\}7Zwb.AIVK^:wb{[uݯcytO߶S<{8KSRׁH̏N7ۚ[xkwYy_'ZӵF+>쌛ZUĦreE9F[24De{}@:ExWs-\ǻ7K-\JNvEk%:s˙#κ].oͳ;լ7wB6nwu:$L; DkI#Wz.:Xp(˅v$Sq,wn\qIN-e<5Oe+vuYTpcojUI_ާP8 O 7&VL8z$_B-H-[uh]T{|8=qVRN-:Ij:7PUtXϷmy鉿:RIM~33ӸS2#׳GdŲ5+/Bx{(WzȨ5Y㞎#|˖+ ط.|e<o/rߔX>7s}VE.OVti׽ .5nNJO"95{#q}Ay9do]R"M6z\tnNS-D!@3N_jicWsy*5uٮRcWv/.,j}=S)j5C^> Ie =gu9ӛqjtz]۪TMoߧI!Ǧ¶m:,"[L!{qAv-o 3{"KʼnrIkfٶj2ƙ؄S`7` k6jzޞ?e5G&6uʷ2%ԒRKE*G\Npom F/V |C0.q_eenƣ<5Oh'67ɪn[SĽ{ڔjǘzs;~׌(ۂ`ܢ1ƣ` _l9Va6%UQWh~P~\F^ZHR@:ۧCJ{ôGeBh;~ۧnU J\O+n2 RҠ)ng}Kh{5+S×ܛ.1ZjG)iRȤIN 4%{oΜ/eO[Nffd ĹK?nnԼMqX'܌nZvq<ķbFnͪaQ`5 s,M_լ?-@_{w{ӺձJ}GF[%v\5[ŒGkOw/ΜM9rjË%2+rd~+󲕛C9U۳r[aJǭm|˒LAʨSCq[XMۺoubfp:t+ΤĻo ][ zt-*67kvS7D·MMCQXm;)܎n_h%]4ܙnRk!]ڵsDUF"`R, &#R_*[z*ZqFXɻ]7|۵w+'pFDەs=r./ᐚm3Hשy yD"jHCr':sA65نѮ^o1V/ f;nFr3VM)e*- s D'H݅fӧ\*޷[k<7u<-]֍Q8R h|p=WlW3s%Q %3l}@U-K6f-NϿu|ڴmWN׮[׸F*mW\%r! C78:޳vBG7ŵ.JթԚ2x)ST!řn~9 W:Wpܢ件{xf8ٳwKE ҰWxVB\qBZ 2wMb[lGSnyԚ~z9ZmያvoN2Afnݽjf>)j3 !;gOYʹK" Wftڎ+׭b*2ϻK>ۢӱeyԪXISUm[z+ugX%0lϏnvg!;t{BqPj>PyvR7Cj]O%+ݲ :qiMj6W}3vC/R=4Som]ŗ=ю, TF6U_-\6MyskwMr&Q\wjKܩyMϣUj0*}RZܷSdY3>Zjqj6TgzpA/M`/Cmл,޻feE[/+uk^Vs1W$G(JsW2ٰu*߻q*Y޵.Wi:ur5T),=0uRmho.twܖiYwrWHntvEj8qhf`Ͻpf(R&>Ki%I7$QӖm-2 ~yߗQ-앑/ x[k8nw.c㩵k}]FkbJl:{.(˩n0Hqvαp7 귎.Gupx[N`Yq'+ruU7[ү+>!xrȫoSo]OC# d^Q]\>!ƛGw^Mx"-+%vdX-:M2UR%d>%l ioSu6lsj7D P>XxHz Ukà(n^Q V>5cVtWj SEiJdznyej[lE' 3kuٌNn4JW)gB {4 j6&]' m-(ZMEz8cz>WZ6#7+[,MR-Z!4ܓtCyE|umj1ƽvƷV\;%>Q :#Le(iVz5 4ũۤUWxX ^(ҔsլB2w-V ^R+; ˂M\z+Uwr+RWY⺧~ Q*JcYSNSλUd8in=v K낫k\IRרSUaCFmϿ5̗P|u ZTԕ}>oYѲ1sfP+sQkX8Gb~6r,s>^\,mGL+7[n-E\.Fqḕcl*Jmjb5 ,m]c}NXfeVlǸJ5eˡ$4%g~N p4Y*WwW٧<8v#;qԩTut,m"#Y D\5V`\\Lȋ];LȇiS6ϝZ l>LruR\v=ǘϔDg=ԈdFZ+M{=|,[;0>RiSi4,S5}yxw&(E7&fݙ4UՕ! ~'Id)]ǽu2K-fޭ \08Vڅ쓬=Vy^^ IhyKR-B#Ըr=]mܻӾ'*Umkoy rTqT_i,/8Q^<ݤ|4ԻO(܄"'5N~#m.(Ҿ2i6Uev&I*<}҄$eNtÛzyWJubW^iBW.܅Wڮg]irO6Ve90sgv.+sV޿aޔ[p?3q*FutUo*eL\KM'EG*ZcAFfG5J 5jj=MJ3OK:k˝'NMB7m3uFҕ\-Ywg%PRqMIyZGY9|μvn߻5cWݷa^+X֥vnݘ\v7m>Fgzv"-;Ew֝}1|RjN𿊀7g#֟*GQQ|#/bo]p$>_Un9гUbn9׃ErQBU-^vDmVh'<R[fdHT]*~}3j;nvjc7s-rӳ Y8[n[1pJx kX[Jk9Mn!_Nю6x:iZ˦U |߉^Ԛ݃hYxk &U^bwKk.[jE+P(˞=9j@snCv7%c_7=xǁ<l {t'酚+1F‹l׭:ݻILruǶkL-L(K0L1&>wXB(pm;1fpnlp֓%Skidkt(U +xulo'/ڕeN r=^pZZ:Pnj8Hf"48ijY[ N[yZٻ+=  ø:3 ?^ܷ^Sr#YK[UF?CuhC b]GM')mڏsNrܗI]ljq6VB. W,UK"YX5{c >Iqā> T:n!,5l2VzCl|+I[*SrjnS6٨y+x,@>П.g+!rn9>N|W>OZT_ut Y""v7|sfި;Pclm EùN,{'fNT%U&LfH8~1v>Il}统u6P˗c(WV~H^bMU.o*oOF0N:_:6Smr_.b+|ݶYY غF,mwjv>f*>QM뭱Sd:`N{l/⎱;n-z~"Gze퇎J5S KG9!Gn;N1 ݎ h6m|S?ɂ5'WOÞ 7|7^ao @mxGmi^jϽ>01Mf0լD3-2T. VXR"ɥV Kl J O7|u?bvа;6.eߓ|[1bmRr,eRz`z 6܎-ͨku͹Fː dPhYgZUj}nvX;z=gVեTv_J }\1n7w2J?ޘγc\E 1Aޑzq;\r]]\Y&[nsNei\uURje*Qk2CSl*xJz-xٶlm+|UjUؓ`Ladqiĩ!Gd\W~fz;Tn*PdRM&T4`չSWq5k훶(N"Ӎ% V]֦wb.nUO!u*J&Oӕ2e|Z=eV쫚΅g#+/RW:طnbi*Wyo)p{:ETKؚR(RY+r웓r(IF) VmȵNB:h Q1ғ|u8E]{,'$-TR[j49l*3"I鯴zhd>Q+\BkNF=.$ZR4Nwհ(IpNi.(Gi33#33e$FXK*NdWrud[r{xnk$v2ıh+J1TQ[#JQl[tRO]LHKٮ NӍnF񨔤֞Em'MILB"ԋ%dBŋ+p̿_17jzT~4pc Vo\ƹb9Rq-'1j;8ܗ)hE%DZKS<璸Bu*%*Yw5ڻ9ۣ^z4U; Ñk\U(o~G?VUĎ:?P?_F_Kߤ~ᓾI |pr.Ok\SklRhҪz{­P .}SktZ7UQ4ڌIM8̈eaӊJZ%FFZu,KZvln廐SNFIVtuNi?CM5]+Ph,{jN JSR$IS^tSUVrORYu.9WyP6 [Kiu m!X|]Y79ӄ)\ģ)pbڳr%*&ꑶ_-H*dzk)1 V3')UAϹٶWRxe'պn۫h7AR9 EAJeGLms!%D| A 5]/Q3eb̄vnVn%za\m kZnv([emqrIҕij|""><hjJשvvǕ|Pޟs}V~2&Z?+2N&Z4w@)4iSڪ_>/JN9Hiۏuf8'It[ȲR.hZ$ȋ_Y ~U<UUO*6b)Ovzڜj\R̋.$FsQuҊj^נ䈈y<zZIuP[}Qm=C?zN(Exqu/kn S-FzKZzOסӽjJ\)F3b!r5ٝ|;6 o=-3*λ]αb\abqRi-w޵⦪~b8Kpo)Z=>)ғ"5/GTZLE-輵f7ݘ۹~+&+w/7GFI:l33fg.N~۲\2|*cnermnnM+Fq"ѪIz%j =YW8@~gc/~?N'?)«qȸs➟n=k" X“m֮VreMh2[uݖ] *FܖN)MȐ`f0 g,C9̑o;ddudJ=In13:ݒvvdMUEJLp^,6t-@͐9'{7m{-3,>hnF;ѰM)->>+Ěz!R* :`e--m7nB\u{b U>[8֪]6^ߤLʦ\DFNo$$dͶlgno8OrsQ\l̯hRo8tuNo+ CTxu!2[>ctFpeޓƻֶR"3QrQuOѳgwQr;S~)6HhZw/GgVTmUf_yt7%$];zLWF̰xy2Ʉu!MCmš_0[W6jf#a-KLi+3Q7c^qg%s<1aYIQeZf+}>;S6L0]Yu_h9߻<ƅpmiM$AVvŚ,*#t2.8Y)-Zhshü97/#Oro"u^/uFgWɺ,p:6a,^x%$Yve^3PƗMnTP&yS}OJ '덫MH^:rXԴJۋ/rI;S*,+yz1hv)Qw^ڍJ2oL׊q(\fDj:^T%vOadɂnS}ZO)N*λdaȜkG_PIEO}нa(^iQX᯦-7^)%g'SJx(.S9zVɴZ{E ))ۅi/s7 VIV-|sj0*UBTHIqRf>FP$KqN0 R̻8j\GcC}IUz\i 6F)Q{Gҧ3qSzKj-Az VЛS-zy:8*mNk|D鿓ND2u+0Yŝ7kqm·?8Ib]u>˗^_>(]vӋzv+ݩ){vZrJ2RQ몋C$z [,pp,8mڊbR]Il .f~d/ݓs㓓mͶ{mgjQwn=Oic9ܚm4Q/6ݨ[TƧ?nԶoytf{@AzT{e{[O'ZRZt~AGD?s3􌿂ՉIw'|~U\ w~di:Kޱ)U/sU%njѩ&GSP^ǝd)..!^U` 1wX[aԇSxoFV6_扐)T 2Mfd=ۖͭiZ7KK Bi9%7@<3<ճԻU,},a}FRqɛr i@ONJvK KLN M, ʖv0n-]DwlI-X6ܶ$Jʴh5O+mOI+Ra瞠\ MG7BفjYo1#͖0V`Ѱ2M?c8>-Crt*JkIGS:e#hPKx[鱼>{5m;wcն&>j-M֥^َ) 6yȜl_w{-ō̱r> U=]iw3)r*]:K]6BdCTZ|>gf}LW}[$'Y5 &c -j.z6R 67MԷFMnÌwI7w5E}o޽+K ֵy4܌ȥW"COyR[q5Ӱ͙f[v"_#q{MV6܍3"u9BK(41ӯqˇc${ߝCi6I(OmθzҜ5k^:>Jzw.>qV8{vU[ڶEm|DžBz].KHjI]x;Mɗ{m,qZXr忇2u^RO2Z}ZێS[2Jen!*NDcrBUً4<ǼMҲs1Zw57c3&ĖڻzmP*FuJG1-dN:|OU}ҵgi2t~F^^Z.VxjvŧnNNh<:]^~NN+ge^g.SԔGFe߯'[vn'(ScJ]kܗ7eJOlRrfziݮq̋S"\*U<*W]k$FջV}? 7g#֟*GQQ|#/bo]p$>_Un9;l S VvQU%OLU{οmU6bZ1MTx%!֙Q7, J=!3 ;Q,ڌ;6ͱ݅q^&ߔ·n #WbwӖX.HtG)N&d̵zpI,n cu ޖUj+VXUp[w]N o.J6Z8Ts&utxln;~HPHS/xw`G\ʡ¿rj Z^vt"[L:SD\h0sUwR,}[x^X,R2Vn< ]2YDr[SRKs8tXb̷G?Ps Tv 3be,zVz D[/I.KOEQrm'$7|[J>r S`5յwT#\w1FTz\Ԛ &"ׅhSHrD\'r]~/>p;:Piuu:"9ő=tTaS7V2rӷk7mb[^WmPp*[y.Þ6f]cizJCgRR@UVl큝.WJP1N{/\whZ ػϧӱE7|E֫Sί.x-Y&pi%v''-x6r'Ws*6=DwwUu]=C?MK [yrtܒG$!WGqJ*%SAz ED[^)/tė/g=#Omd.|^n/sl׉g DZqemqowݮRzUܜ=ڽ-o/Iۖ;qVʘgPp|mm;6zGl9.8pwWgsJ2qPbe}}UpNjٯ}7TMQKrؽtEx%v w߾8%|j;~|}pK]ơ/ w߾8%|j;~|}pK]ơ/ w&~e_H 8PL7:%ʭ5Kw&U2vwR_+rm'}C7#rWoO&HoG?M$UR7{FU]u ;# !Wk`|W>׹潇9Vn)6)*ҹ{%qV4q>W1vi#T"Qk&GwxcJBJ- Ϸ^ˁxkU}ԣ/3.;]J=<*)cS)ROK9H=,r zX @)cS)Da^ԽQ gxJI=w֣gf*TRj

Corresponding author (hhkong@knu.ac.kr)
• Received: September 30, 2009   • Revised: October 5, 2009   • Accepted: October 5, 2009

Copyright © 2009 by The Korean Society for Parasitology

  • 20,205 Views
  • 195 Download
  • 19 Crossref
  • 22 Scopus
  • After morphological grouping of Acanthamoeba by Pussard and Pons, phylogeny of the genus has been always a big topic to the researchers. Because of the variability of morphological characteristics, unchangeable and stable characters have been investigated for phylogenic criteria. Isoenzyme and mitochondrial DNA RFLP (Mt DNA RFLP) analyses revealed different patterns among strains assigned to a same species. Therefore, these characteristics would be considered as tools for strain discrimination than species identification. The most recently developed and the most promising method is the sequence analysis of 18s ribosomal RNA coding DNA (18s rDNA). The phylogenic tree based on comparison of 18s rDNA sequences distinguished the 3 morphological groups of Acanthamoeba and divided them into 12 unique sequence types (T1-T12 genotypes). Most clinical and environmental isolates belonged to the morphological group II and the genotype T4. In the Republic of Korea, 2 strains of Acanthamoeba, YM-2 and YM-3, were first isolated from the environment in 1974. However, phylogenic identification of Korean Acanthamoeba isolates from human infections or the environment were tried from the late 1990s. By RFLP analysis or total sequence analysis of 18s rDNA revealed that almost all clinical isolates including the one from a suspicious granulomatous amebic encephalitis patient belonged to the genotype T4. A large number of environmental isolates from contact lens storage cases, tapped water, and ocean sediments also belonged to the genotype T4. Almost identical strain characteristics, such as Mt DNA RFLP pattern of environmental isolates, with the clinical isolates could make a simple conclusion that most environmental isolates might be a potential keratopathogen.
The genus Acanthamoeba Volkonsky, 1931 has adapted to live in a variety of human environments, such as soil, air, freshwater, swimming pools, tap water, and ocean sediments. Recently, medical protozoologists have paid attention to Acanthamoeba since several species of the genus have been known to cause life-threatening granulomatous amebic encephalitis (GAE) in immunocompromised individuals and sight-threatening amebic keratitis in contact lens wearers. The incidence of Acanthamoeba keratitis infection has increased exponentially during the last 30 years [1,2]. Up to the year 2009, 2 suspicious GAE cases were found to be infected with Acanthamoeba spp. in the Republic of Korea [3,4]. These patients died of meningoencephalitis. In addition, 1 case of Acanthamoeba pneumonia with an immunodeficiency status was reported [4]. In the case of Acanthamoeba keratitis, the incidence is increasing from the early 1990s and more than 30 cases were reported already.
Despite the medical importance of the genus, identification and classification of acanthamoebae at the subgenus level has been problematic. The identification of Acanthamoeba at the generic level can be easily accomplished by the morphological characteristics. Pussard and Pons [5] divided the genus into 3 morphological groups according to the cyst size and other morphological features. Group 1 consists of Acanthamoeba spp. with relatively large cysts, distinctly stellate endocysts, and smooth spherical ectocysts. Group 2 and group 3 Acanthamoeba spp. have smaller cysts (less than 18 µm in diameter). Species in Group 2 have polygonal to stellate endocysts with irregular or wrinkled ectocysts, while the cysts of group 3 species have rounded or slightly angular endocysts with tinner and smooth or slightly wrinkled ectocysts. The grouping has been widely used before species identification of the amoeba. However, the morphologic characteristics of the cyst can change with the culture conditions [6,7] and highly variable within the same strain (Fig. 1). Therefore, species identification by morphology alone can hardly be possible [8].
Investigators have used several kinds of non-morphological methods for the taxonomy of Acanthamoeba spp. Among the methods, isoenzyme analysis, RFLP of mitochondrial DNA (Mt DNA), RFLP of small subunit ribosomal DNA (ssu rDNA), and the sequence analysis of ssu rDNA have been recently applied and regarded promising. In this paper, the potential of these molecular methods for the phylogeny of Acanthamoeba, and the molecular phylogeny of Acanthamoeba korean isolates, were briefly reviewed.
Isoelectric focusing of isoenzymes had been applied for identification of Acanthamoeba spp. Studies of isoenzyme patterns [9-12] suggested the other groupings of Acanthamoeba strains that are not consistent with previous species assignment based on the morphological criteria of Pussard and Pons [5]. De Jonckheerez [13] examined 30 strains of 15 Acanthamoeba species for the isoenzyme patterns by agarose isoelectric focusing (IEF) in the pH range 3-10. Comparing zymograms of 5 enzymes, he reassigned the strains of amoebae to each species. Kong et al. [14] observed the interstrain polymorphism of the isoenzyme profiles among 7 strains of Acanthamoeba morphologically assigned to Aanthamoeba polyphaga. Since considerable variation of zymograms was noted within a species of Acanthamoeba, isoenzyme study alone is not regarded fully sufficient for species identification.
Mt DNA RFLP analysis has also been applied for taxonomy of Acanthamoeba. Bogler et al. [15] prospected the availability of Mt DNA RFLP for the identification of Acanthamoeba after analysis of 13 strains. They observed that most of the Acanthamoeba strains had distinct fragment patterns of Mt DNA. Yagita and Endo [16] also analyzed 8 isolates which had been identified as Acanthamoeba castellaniii or A. polyphaga, and reported variability of Mt DNA digestion phenotypes among different strains of A. castellanii. Kong et al. [14] confirmed the variability in digestion phenotype of A. polyphaga as well as that of A. castellanii. As for the interstrain sequence diversity of Mt DNA of Acanthamoeba, other investigators reported similar results [15,17-19].
Considering profound interstrain diversity in a species of the Mt DNA RFLP and alloenzyme profiles, Kong et al. [14] and Chung et al. [20] suggested that both analyses should be used for strain identification, differentiation, and characterization rather than species identification.
PCR-based DNA restriction analyses of 18s rDNA (riboprinting) of Acanthamoeba showed promising results for species differentiation of Acanthamoeba [21]. The sequence of primers for PCR was designed to hybridize at the highly conserved sequences at the 5'and 3'termini of eukaryotic ssu rDNA [22]. They analyzed 23 reference strains of Acanthamoeba, including 18 (neo) type strains for classification at the subgenus level by riboprinting. The dendrogram based on the riboprinting coincided well with the grouping of Pussard and Pons [5] based on the morphological features of the cysts. Khan and Paget [23] applied similar methods to identify clinical and environmental isolates from UK. They amplified a part of 18S rDNA with genus-specific primers [23] and digested the products with restriction enzymes. The riboprinting can be applied for rapid identification of Acanthamoeba isolated from the clinical and environmental specimens under limited condition to obtain the DNA sequence of the samples.
The most recently proposed method for molecular taxonomy of Acanthamoeba is 18s rDNA sequence analysis. Byers group investigated the 18s rRNA gene phylogeny [24,25]. After the examination of the 18s rDNA sequence variation in a group of 53 strains that includes the morphologically assigned 18 isolates and 35 new isolates, they suggested 12 sequence types (T1-T12). The sequence types were defined as the sequences or groups of sequences that differ from all other sequences by at least 6%. In the phylogeny by 18s rDNA sequence analysis, 3 morphological groups were clearly distinguished. Each of the morphological groups consisted of several different lineages of sequence types. Three species in the morphological group I were identified as T7 for Acanthamoeba astronyxis, T8 for Acanthamoeba tubiashi, and T9 for Acanthamoeba comandoni. In group 3, Acanthamoeba culbertsoni was identified as T10 and A. healyi as T12, and Acanthamoeba palestinensis, Acanthamoeba pustulosa, and Acanthamoeba lenticulata represented T1, T2, and T5, respectively. The other 3 types, T3, T4, and T11 are included in group 2; T3 for Acanthamoeba griffinii and T11 for Acanthamoeba hatchetti and Acanthamoeba stevensoni. The biggest lineage T4 contains all the remaining group 2 isolates. However, by this system, the relationship among all taxa within T4 was not clearly defined. Strains in T4 are too closely related to be resolved fully by use of 18s rDNA sequences. They proposed that each sequence type should be equated with a single species. The various species in T4 might be all reclassified as A. castellanii, because the sequence type includes the type strain for that species.
Although phylogeny by 18s rDNA sequence analysis has a limitation to distinguish species in sequence type T4, it is practical to classify clinical or environmental samples for species identification. Now the identification of a new isolate of Acanthamoeba from clinical sample or environment is performed mainly by 18s rDNA sequence analysis [26-29].
With the 18s rDNA sequence analysis, reassignment of several Acanthamoeba spp. originally assigned by morphological criteria have been suggested. Chung's group evaluated the taxonomic validity of 4 species of Acanthamoeba; A. divionensis, A. paradivionensis, A. mauritaniensis, and A. rhysodes and suggested that 3 species should be regarded as synonyms of A. rhysodes. They exhibited 18s rDNA sequence differences of 0.2-1.1 with each other.
Since most clinical or environmental isolates belong to 18s rDNA sequence type T4, many investigators prefer to classify an isolate as their genotypes than scientific names even in the case of already named species, such as A. castellanii Castellani. It is necessary and urgent to define the strains in the genotype T4 as a species complex or as several species based on other molecular characteristics.
The value of mitochondrial small subunit rRNA gene (mt ssu rDNA) analysis as a taxonomic tool for Acanthamoeba isolates with close interrelationship was also evaluated [30,31]. Mt DNA is a molecular clone within mitochondriate eukaryotic cells like Acanthamoeba. Merit of Mt ssu rDNA is lack of intron, and smaller and more consistent in size than nuclear ssu rDNA. Yu et al. [30] compared the phylogeny based on the PCR-RFLP pattern of mt ssu rDNA with that of genomic ssu rDNA PCR-RFLP. Ledee et al. [31] analyzed Mt ssu rDNA sequences of 68 isolates and constructed a phylogenetic tree. The similar genotype clustering by Mt ssu rDNA analysis with that by nuclear ssu rDNA genes indicated that those clustering represent the main branches in the phylogeny of Acanthamoeba. Moreover, based on the subgrouping of T4 genotypes into 8 clades, they suggested that Mt ssu rDNA sequence may serve as the best available molecular basis for differentiating the species with this genotype.
It was middle of the 1970s that the first suspicious Acanthamoeba meningoencephalitis case was reported in the Republic of Korea [3]. The patient was a 5-year-old boy who developed multiple subcutaneous, non-tuberculous granulomas in many organs, and died of meningoencephalitis. However, unfortunately the organism identification was not performed. It was also in the middle of the 1970s that the first strain of Acanthamoeba was isolated in Korea [32]. Acanthamoeba spp., YM-2, YM-3, and YM-4, were isolated from water puddles, a storing reservoir, and the gill of fresh water fish. However, the phylogenic positioning of those isolates was tried quite long time later because of lack of standardized species identification system.
Molecular phylogeny of clinical isolates
The second case of Acanthamoeba meningoencephalitis in Korea was a 7-year-old boy with facial laceration near eyebrow by accident. Acanthamoeba trophozoites were observed in his skin biopsy after his death [4]. However, species identification of the causative Acanthamoeba was tried after 13 years later based on 18s rDNA partial sequence analysis. For partial amplification, 2 sets of genus-specific primers were designed to hybridize to the specific regions of 18S rDNA of the genus Acanthamoeba (Fig. 2). The primer sets, VR1 and VR2, encompassing the variable regions of A. castellanii Castellani 18S rDNA were designed to hybridize from 111-326 and 822-1,090 nucleotide numbers, respectively. The sequences of these primers were as follows: VR1F (TTATAGTTTATTTGATGGTC), VR1R (TGCGATCCGAAAGA-GTTACT), VR2F (CCGTCCCCTCCTTCTGGATT) and VR2R (CTATCCCTATT-AATCATTAC). Two fragments, sized 200 and 270 bp, of the variable region of 18s rDNA was amplified by PCR from the paraffin block of the skin biopsy. Combined sequences of 2 variable regions were subjected to construct phylogenetic tree by comparison with that of reference strains (Fig. 3). The causative organism of the case was identified as A. castellanii complex (T4 genotype) and was genetically closely related to 2 clinical isolates. AY026243 is A. polyphaga Jones strain, the first Acanthamoeba keratitis isolate [33], and the other strain U07410 is also isolated from a keratitis patient in the USA.
Four Acanthamoeba isolates (KA/E2, KA/E12, KA/E15 and KA/E16) from infected cornea of Korean patients were reported as Acanthamoeba lugdunensis based on the Mt DNA RFLP and riboprinting of 18s rDNA [34]. Three isolates, with the exception of KA/E15, revealed the identical Mt DNA RFLPs and riboprint patterns with Acanthamoeba L3a, the type strain of A. lugdunensis. Identification of the isolates as A. lugdunensis was confirmed by 18s rDNA sequence analysis. The sequence difference of the 4 isolates from L3a strain was 0.1% to 0.4%, and that from A. castellanii Castellani was 1.2% to 1.5%.
Amebic keratitis related to orthokeratology lens overnight wear was reported in a 15-year-old girl who wore the lens for 10 months [29]. Based on the 18s rDNA sequence analysis, the infected Acanthamoeba was identified as the genotype T4 and very closely related to A. castellanii Ma strain which had been isolated also from amoebic keratitis.
Xuan et al. [35] characterized 3 Acanthamoeba isolates (KA/E9, KA/E17, and KA/E23) from Korean keratitis patients and identified as Acanthamoeba triangularis by the 18s rDNA sequence homology. The 3 isolates showed 1.3-1.6% of 18s rDNA sequence differences from A. triangularis. Although the cyst morphology of the 3 isolates was not identical with A. triangularis, their mitochondrial DNA RFLP was very similar with that of A. triangularis.
Here we present the phylogenetic tree of Acanthamoeba by 18s rDNA sequence analysis of 22 known strains as reference strains and 10 clinical isolates (KA/E series) from Korean keratitis patients (Table 1 & Fig. 4). All clinical isolates from Korean patients belonged to the morphological group II and identified as the sequence type T4. They scattered into 4 subclades within T4. It is not certain to assign them as separate species or A. castellanii species complex. By Mt 16S rDNA sequence analysis of Korean keratitis isolates, the strains in the T4 genotype were subgrouped into 5 clades (Fig. 5). A. castellanii Castellani and A. lugdunensis L3a belonged to different clades. With these results, we confirmed the potential of Mt 16s rDNA to identify species in genotype T4 as suggested by Ledee et al. [31].
Molecular phylogeny of environmental isolates
Acanthamoeba isolate from Korean soil with strain name KA/S2 was characterized by Chung et al. [20]. Mt DNA RFLP patterns of KA/S2 were identical with those of the Neff strain originally isolated from the soil of the USA.
By a nationwide survey on the contamination rate of Acanthamoeba in contact lens storage cases, 110 Acanthamoeba isolates were identified and characterized by comparison of riboprinting and Mt DNA RFLP with those of reference strains obtained from American Type Culture Collections (ATCC) [36-38]. All isolates from the lens storage cases belonged to the morphological group II and were identified as the genotype T4. Their individual genetic characteristics by Mt DNA RFLP showed that the most common pattern was that of A. lugdunensis L3a and KA/E2, the type stain and a corneal isolate from a Korean keratitis patient, respectively. Another common pattern was that of A. castellanii Castellani and KA/E3, the type strain and another corneal isolate found in Korea. The pattern of A. castellanii Ma strain, a corneal isolate from the USA was also quite common in some part of Korea. The prevalent pattern for each type of Acanthamoeba in southwestern area was very different from that in southeastern areas and Seoul, Korea [38]. Most Acanthamoeba isolates from domestic tap water were identified as potential keratopathogens based on the molecular characteristics of Mt DNA RFLP and 18s rDNA sequence analysis [39]. Interestingly, the Mt DNA RFLP patterns of 5 isolates from contact lens storage cases were found to be the same as those of isolates from the lens owner's domestic tap water.
Acanthamoeba isolates from ocean sediments of Korea showed big diversity in genetic characteristics compared to the isolates from contact storage cases [40]. All of 18 isolates belonged to the morphologic group II. Fifteen isolates showed close relatedness with clinical isolates and A. castellanii Castellani, and they formed a lineage equivalent to the T4 genotype. Two reference strains from the ocean sediment, A. hatchetti BH-2 and A. griffini S-7, clustered unequivocally with these 15 isolates.
Im and Shin reported [41] an isolate from a freshwater fish in Korea as a new species of Acanthamoeba and assigned as Acanthamoeba sohi, based on random amplified polymorphic DNA marker analysis, Mt DNA RFLP, and 18s rDNA sequence analysis [41]. The isolate belonged to the morphologic group III and formed a different clade from 3 reference strains of group 3, A. culbertsoni, A. healyi, and Acanthamoeba royreba in the phylogenic tree.
Although various molecular characteristics have been applied for the taxonomy of Acanthamoeba up to date, hitherto species identification system needs to be improved. Sequence data of 18s rDNA may provide information for genotyping or grouping to the most closely related known species. Mt 16s rDNA sequence analysis could be an additive data to subgroup the strains in the genotype T4, to which most clinical and environmental isolates belong. More detailed molecular characteristics could be obtained by isoenzyme analysis and Mt DNA RFLP. Comparison of molecular characteristics of clinical or environmental isolates with already identified strains is also a short way to identify a new isolate.
The author thanks Prof. Dong-Il Chung, Kyungpook National University School of Medicine, for careful reading of this manuscript and helpful discussions.
  • 1. Awwad ST, Petroll WM, McCulley JP, Cavanagh HD. Updates in Acanthamoeba keratitis. Eye Contact Lens 2007;33:1-8.
  • 2. Patel DV, McGhee CN. Acanthamoeba keratitis: a comprehensive photographic reference of common and uncommon signs. Clin Experiment Ophthalmol 2009;37:232-238.
  • 3. Ringsted J, Jager BV, Suk D, Visvesvara GS. Probable acanthamoeba meningoencephalitis in a Korean child. Am J Clin Pathol 1976;66:723-730.
  • 4. Im K, Kim DS. Acanthamoebiasis in Korea: two new cases with clinical cases review. Yonsei Med J 1998;39:478-484.
  • 5. Pussard M, Pons R. Morphologie de la paroi kystiqueet taxonomie du genre Acanthamoeba (Protozoa, Amoebida). Protistologica 1977;8:557-598.
  • 6. Sawyer T. Acanthamoeba griffini, a new species of marine amoeba. J Protozool 1971;18:650-654.
  • 7. Stratford MP, Griffiths AJ. Excystment of the amoeba Hartmannella castellanii. J Gen Microbiol 1971;66:247-249.
  • 8. Visvesvara GS. Classification of Acanthamoeba. Rev Infect Dis 1991;13(suppl 5):S369-S372.
  • 9. Costas M, Griffiths AJ. The suitability of starch gel electrophoresis of esterases and acid phosphatases for the study of Acanthamoeba taxonomy. Arch Protistenk 1980;123:272-279.
  • 10. Costas M, Griffithes AJ. The characterization of 71 strains of Acanthamoeba using starch electrophoresis of isozymes. (Abstr). 7. 4th Int Cong Protozool. Warsaw, Poland: Progress in Protozoology 63.
  • 11. Costas M, Griffiths AJ. Enzyme composition and the taxonomy of Acanthamoeba. J Protozool 1985;32:604-607.
  • 12. Mathews HM, Moss DM, Healy GR, Visvesvara GS. Polyacrylamide gel electrophoresis of isoenzymes from Entamoeba species. J Clin Microbiol 1983;17:1009-1012.
  • 13. De Jonckheere JF. Isoenzyme and total protein analysis by agarose isoelectric focusing, and taxonomy of the genus Acanthamoeba. J Protozool 1983;30:701-706.
  • 14. Kong HH, Park JH, Chung DI. Interstrain polymorphisms of isoenzyme profiles and mitochondrial DNA fingerprints among seven strains assigned to Acanthamoeba polyphaga. Korean J Parasitol 1995;33:331-340.
  • 15. Bogler SA, Zarley CD, Burianek LL, Fuerst PA, Byers TJ. Interstrain mitochondrial DNA polymorphism detected in Acanthamoeba by restriction endonuclease analysis. Mol Biochem Parasitol 1983;8:145-163.
  • 16. Yagita K, Endo T. Restriction enzyme analysis of mitochondrial DNA of Acanthamoeba strains in Japan. J Protozool 1990;37:570-575.
  • 17. Gautom RK, Lory S, Seyedirashti S, Bergeron DL, Fritsche TR. Mitochondrial DNA fingerprinting of Acanthamoeba spp. isolated from clinical and environmental sources. J Clin Microbiol 1994;32:1070-1073.
  • 18. Byers TJ, Hugo ER, Stewart VJ. Genes of Acanthamoeba: DNA, RNA and protein sequences (a review). J Protozool 1990;37:17S-25S.
  • 19. Kilvington S, Beeching JR, White DG. Differentiation of Acanthamoeba strains from infected corneas and the environment by using restriction endonuclease digestion of whole-cell DNA. J Clin Microbiol 1991;29:310-314.
  • 20. Chung DI, Kong HH, Yu HS, Oh YM, Yee ST, Lim YJ. Biochemical and molecular characterization of a strain KA/S2 of Acanthamoeba castellanii isolated from Korean soil. Korean J Parasitol 1996;34:79-85.
  • 21. Chung DI, Yu HS, Hwang MY, Kim TH, Kim TO, Yun HC, Kong HH. Subgenus classification of Acanthamoeba by riboprinting. Korean J Parasitol 1998;36:69-80.
  • 22. Bhattacharya S, Som I, Bhattacharya A. The ribosomal DNA plasmids of Entamoeba. Parasitol Today 1998;14:181-185.
  • 23. Khan NA, Paget TA. Molecular tools for speciation and epidemiological studies of Acanthamoeba. Curr Microbiol 2002;44:444-449.
  • 24. Kong HH, Chung DI. PCR and RFLP variation of conserved region of small subunit ribosomal DNA among Acanthamoeba isolates assigned to either A. castellanii or A. polyphaga. Korean J Parasitol 1996;34:127-134.
  • 25. Gast RJ, Ledee DR, Fuerst PA, Byers TJ. Subgenus systematics of Acanthamoeba: four nuclear 18S rDNA sequence types. J Eukaryot Microbiol 1996;43:498-504.
  • 26. Stothard DR, Schroeder-Diedrich JM, Awwad MH, Gast RJ, Ledee DR, Rodriguez-Zaragoza S, Dean CL, Fuerst PA, Byers TJ. The evolutionary history of the genus Acanthamoeba and the identification of eight new 18S rRNA gene sequence types. J Eukaryot Microbiol 1998;45:45-54.
  • 27. Schroeder JM, Booton GC, Hay J, Niszl IA, Seal DV, Markus MB, Fuerst PA, Byers TJ. Use of subgenic 18S ribosomal DNA PCR and sequencing for genus and genotype identification of Acanthamoebae from humans with keratitis and from sewage sludge. J Clin Microbiol 2001;39:1903-1911.
  • 28. Yu HS, Kong HH, Kim SY, Hahn YH, Hahn TW, Chung DI. Laboratory investigation of Acanthamoeba lugdunensis from patients with keratitis. Invest Ophthalmol Vis Sci 2004;45:1418-1426.
  • 29. Lee SJ, Jeong HJ, Lee JE, Lee JS, Xuan YH, Kong HH, Chung DI, Ock MS, Yu HS. Molecular characterization of Acamthamoeba isolated from amebic keratitis related to orthokeratology lens overnight wear. Korean J Parasitol 2006;44:313-320.
  • 30. Yu HS, Hwang MY, Kim TO, Yun HC, Kim TH, Kong HH, Chung DI. Phylogenetic relationships among Acanthamoeba spp. based on PCR-RFLP analyses of mitochondrial small subunit rRNA gene. Korean J Parasitol 1999;37:181-188.
  • 31. Ledee DR, Booton GC, Awwad MH, Sharma S, Aggarwal RK, Niszl IA, Markus MB, Fuerst PA, Byers TJ. Advantages of using mitochondrial 16S rDNA sequences to classify clinical isolates of Acanthamoeba. Invest Ophthalmol Vis Sci 2003;44:1142-1149.
  • 32. Hwang HK, Im KI, Soh CT, Yun DJ. Experimental study on the pathogenicity of free-living amoebae. Yonsei J Med Sci 1976;9:182-194.
  • 33. Jones DB, Visvesvara GS, Robinson NM. Acanthamoeba polyphaga keratitis and Acenthamoeba uveitis associated with fatal meningoencephalitis. Trans Ophthalmol Soc (UK) 1975;95:221-232.
  • 34. Yu HS, Kong HH, Kim SY, Hahn YH, Hahn TW, Chung DI. Laboratory investigation of Acanthamoeba lugdunensis from patients with keratitis. Invest Ophthalmol Vis Sci 2004;45:1418-1426.
  • 35. Xuan YH, Chung BS, Hong YC, Kong HH, Hahn TW, Chung DI. Keratitis by Acanthamoeba triangularis: report of cases and characterization of isolates. Korean J Parasitol 2008;46:157-164.
  • 36. Lee SM, Choi YJ, Ryu HW, Kong HH, Chung DI. Species identification and molecular characterization of Acanthamoeba isolated from contact lens paraphernalia. Korean J Ophthalmol 1997;11:39-50.
  • 37. Yu HS, Choi KH, Kim HK, Kong HH, Chung DI. Genetic analyses of Acanthamoeba isolates from contact lens storage cases of students in Seoul, Korea. Korean J Parasitol 2001;39:161-170.
  • 38. Kong HH, Shin JY, Yu HS, Kim J, Hahn TW, Hahn YH, Chung DI. Mitochondrial DNA restriction fragment length polymorphism (RFLP) and 18S small-subunit ribosomal DNA PCR-RFLP analyses of Acanthamoeba isolated from contact lens storage cases of residents in southwestern Korea. J Clin Microbiol 2002;40:1199-1206.
  • 39. Jeong HJ, Lee SJ, Kim JH, Xuan YH, Lee KH, Park SK, Choi SH, Chung DI, Kong HH, Ock MS, Yu HS. Acanthamoeba: keratopathogenicity of isolates from domestic tap water in Korea. Exp Parasitol 2007;117:357-367.
  • 40. Liu H, Ha YR, Lee ST, Hong YC, Kong HH, Chung DI. Genetic diversity of Acanthamoeba isolated from ocean sediments. Korean J Parasitol 2006;44:117-125.
  • 41. Im KI, Shin HJ. Acanthamoeba sohi, n. sp., a pathogenic Korean isolate YM-4 from a freshwater fish. Korean J Parasitol 2003;41:181-188.
Fig. 1
Microphotographs of Acanthamoeba. (A) Trophozoite of A. castellanii Castellani with many characteristic pin-like acanthopodia and numerous vacuoles. Nucleus and a contractile vacuole are prominent. (B) Various shaped cysts of Acanthamoeba with different arm numbers.
kjp-47-S21-g001.jpg
Fig. 2
Schematic diagram of 18s rDNA sequence of A. castellanii Casteallani. (A) 4 variable regions of 18s rDNA are demonstrated with white boxes and named as VR1, VR2, VR3, and VR4. (B) Primer sets for PCR of 2 parts of variable regions are presented.
kjp-47-S21-g002.jpg
Fig. 3
Phylogenetic dendrogram derived by aligning the partial 18s rDNA from the present case and various strains of Acanthamoeba in the database. U07410 and AY026243 are Genbank accession numbers of 18s rDNA sequences of the 2 Acanthamoeba isolates.
kjp-47-S21-g003.jpg
Fig. 4
Neighbour-joining dendrogram based on comparative 18s rDNA sequence analysis showing relationships of Acanthamoeba isolates from Korean keratitis patients to representative members of the genus Acanthamoeba.
kjp-47-S21-g004.jpg
Fig. 5
Phylogenetic analysis using ClustalX and TreeView for Mt 16s rDNA sequence analysis showing relationships of Acanthamoeba isolates from Korean keratitis patients to representative members of the genus Acanthamoeba. T1-T12 mean the sequence type of the strains by 18s rDNA sequence analysis.
kjp-47-S21-g005.jpg
Table 1.
Acanthamoeba strains used in the present study for reference strains and clinical isolates
Table 1.
No Species and strain ATCC No. 18s rDNA Accession No. Source Geographic source
1 A. astronyxis Ray & Hayes 30137 AF019064 Lab water USA
2 A. tubiashi OC-15C 30867 AF019065 Fresh water USA
3 A. comandoni Pussard 30135 AF019066 Soil France
4 A. lenticulata PD2S 30841 U94741 swimming pool France
5 A. culbertsoni Lilly A1 30171 AF019067 human cell culture USA
6 A. healyi OC-3A 30866 AF019070 GAE BWI
7 A. palestinensis Reich 30870 U07411 Soil Israel
8 A. griffini S-7 30731 U07412 Beach bottom USA
9 A. castellanii Neff 50373 U07416 Soil USA
10 A. castellanii Castellani 50374 U07413 Yeast culture UK
11 A. castellanii Ma 50370 U07414 Keratitis USA
12 A. rhysodes Singh 30973 AY351644 Soil UK
13 A. mauritaniensis 1652 50253 AY351647 Soil UK
14 A. paradivionensis AA1 50251 AY351645 Soil France
15 A. divionensis AA2 20238 AY351646 Soil Morocco
16 A. triangulais SH621 50254 AF316547 human feces France
17 A. pustulosa GE3a 50252 AF019050 soil USA
18 A. castellanii CDC:0981:V006 - U07400
19 A. lugdunensis L3a 50240 AF005995 fresh water France
20 Acanthamoeba sp. BP:P23:LCS - FJ422546
21 A. stevensoni RB:F:1 50388 AF019069
22 A. hatchetti BH-2 30730 AF019068 sediment USA
23 Acanthamoeba sp. KA/E2 - AF005998
24 Acanthamoeba sp. KA/E9 - AF316546 keratitis South Korea
25 Acanthamoeba sp. KA/E12 - AF316545 keratitis South Korea
26 Acanthamoeba sp. KA/E15 - AY148961 keratitis South Korea
27 Acanthamoeba sp. KA/E16 - AY148962 keratitis South Korea
28 Acanthamoeba sp. KA/E17 - AY148963 keratitis South Korea
29 Acanthamoeba sp. KA/E21 - EF140633 keratitis South Korea
30 Acanthamoeba sp. KA/E22 - EF140638 keratitis South Korea
31 Acanthamoeba sp. KA/E23 - EF140625 keratitis South Korea

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Molecular Phylogeny of Acanthamoeba
Korean J Parasitol. 2009;47(Suppl):S21  Published online October 26, 2009
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Molecular Phylogeny of Acanthamoeba
Korean J Parasitol. 2009;47(Suppl):S21  Published online October 26, 2009
Close

Figure

  • 0
  • 1
  • 2
  • 3
  • 4
Molecular Phylogeny of Acanthamoeba
Image Image Image Image Image
Fig. 1 Microphotographs of Acanthamoeba. (A) Trophozoite of A. castellanii Castellani with many characteristic pin-like acanthopodia and numerous vacuoles. Nucleus and a contractile vacuole are prominent. (B) Various shaped cysts of Acanthamoeba with different arm numbers.
Fig. 2 Schematic diagram of 18s rDNA sequence of A. castellanii Casteallani. (A) 4 variable regions of 18s rDNA are demonstrated with white boxes and named as VR1, VR2, VR3, and VR4. (B) Primer sets for PCR of 2 parts of variable regions are presented.
Fig. 3 Phylogenetic dendrogram derived by aligning the partial 18s rDNA from the present case and various strains of Acanthamoeba in the database. U07410 and AY026243 are Genbank accession numbers of 18s rDNA sequences of the 2 Acanthamoeba isolates.
Fig. 4 Neighbour-joining dendrogram based on comparative 18s rDNA sequence analysis showing relationships of Acanthamoeba isolates from Korean keratitis patients to representative members of the genus Acanthamoeba.
Fig. 5 Phylogenetic analysis using ClustalX and TreeView for Mt 16s rDNA sequence analysis showing relationships of Acanthamoeba isolates from Korean keratitis patients to representative members of the genus Acanthamoeba. T1-T12 mean the sequence type of the strains by 18s rDNA sequence analysis.
Molecular Phylogeny of Acanthamoeba
No Species and strain ATCC No. 18s rDNA Accession No. Source Geographic source 1 A. astronyxis Ray & Hayes 30137 AF019064 Lab water USA 2 A. tubiashi OC-15C 30867 AF019065 Fresh water USA 3 A. comandoni Pussard 30135 AF019066 Soil France 4 A. lenticulata PD2S 30841 U94741 swimming pool France 5 A. culbertsoni Lilly A1 30171 AF019067 human cell culture USA 6 A. healyi OC-3A 30866 AF019070 GAE BWI 7 A. palestinensis Reich 30870 U07411 Soil Israel 8 A. griffini S-7 30731 U07412 Beach bottom USA 9 A. castellanii Neff 50373 U07416 Soil USA 10 A. castellanii Castellani 50374 U07413 Yeast culture UK 11 A. castellanii Ma 50370 U07414 Keratitis USA 12 A. rhysodes Singh 30973 AY351644 Soil UK 13 A. mauritaniensis 1652 50253 AY351647 Soil UK 14 A. paradivionensis AA1 50251 AY351645 Soil France 15 A. divionensis AA2 20238 AY351646 Soil Morocco 16 A. triangulais SH621 50254 AF316547 human feces France 17 A. pustulosa GE3a 50252 AF019050 soil USA 18 A. castellanii CDC:0981:V006 - U07400 19 A. lugdunensis L3a 50240 AF005995 fresh water France 20 Acanthamoeba sp. BP:P23:LCS - FJ422546 21 A. stevensoni RB:F:1 50388 AF019069 22 A. hatchetti BH-2 30730 AF019068 sediment USA 23 Acanthamoeba sp. KA/E2 - AF005998 24 Acanthamoeba sp. KA/E9 - AF316546 keratitis South Korea 25 Acanthamoeba sp. KA/E12 - AF316545 keratitis South Korea 26 Acanthamoeba sp. KA/E15 - AY148961 keratitis South Korea 27 Acanthamoeba sp. KA/E16 - AY148962 keratitis South Korea 28 Acanthamoeba sp. KA/E17 - AY148963 keratitis South Korea 29 Acanthamoeba sp. KA/E21 - EF140633 keratitis South Korea 30 Acanthamoeba sp. KA/E22 - EF140638 keratitis South Korea 31 Acanthamoeba sp. KA/E23 - EF140625 keratitis South Korea
Table 1. Acanthamoeba strains used in the present study for reference strains and clinical isolates