In February 2009, a small familial outbreak of trichinellosis due to consumption of raw pork occurred in a village of Linzhi prefecture of Tibet, southwestern China. The raw pork samples of the residue posterior leg during this outbreak were collected, and examined by the compression method and histological sections; the encapsulated Trichinella larvae were found. The pork was cut into pieces and digested with 0.33% pepsin (1:31,000) - 1% HCl for 4 hr at 43℃ [7,8]. The muscle larvae were recovered after artificially digesting the pork. After washing, individual muscle larvae were stored at -80℃ until used. This Tibet Trichinella isolate was also maintained by serial passage in 6-week-old, SPF male Kunming mice (Experimental Animal Center of Henan Province, China) at 6- to 8-month intervals in our department (Department of Parasitology, Medical College, Zhengzhou University). The reference Trichinella isolates used in this study was T. nativa (ISS10) and T. nelsoni (ISS29), which were obtained from the Trichinella Reference Center (IRC; Rome, Italy), and Henan isolate of T. spiralis (ISS534) from domestic pigs in Nanyang city of Henan Province, China.

For multiplex PCR, about 20 muscle larvae recovered from the naturally infected pork were each washed 3 times in Hank's Balanced Salt Solution, pelleted, and subjected to genomic DNA extraction utilizing a DNeasy Tissue Kit (Qiagen Inc., Valencia, California, USA). Trichinella larvae were identified at the species level by multiplex PCR, as previously described [9]. The PCR-amplified fragments were visualized by agarose gel electrophoresis (2% standard agarose).

For further confirmation of molecular identification of the Tibet Trichinella isolate, the 5S ISR and mt-lsrDNA fragments of the Tibet isolate and reference T. spiralis Henan isolate were amplified using the following primers: 5' GCGAATTCTTGGATCGGAGACGGCCTG and 5' GCTCTAGACGAGATGTCGTGCTTTCAACG for 5SISR, 5' WACAATGGTCCTTTCGTACT and 5' TGAGGACATTAAGGTAGC for mt-lsrDNA [10,11]. PCR products of the Tibet Trichinella isolate and reference T. spiralis Henan isolate were delivered to Shanghai Sangon Biological Engineering Technology & Services Co., Ltd. (Shanghai, China), which were purified and directly sequenced using 15 pmol of the PCR primers with an ABI PRISM 3730 Genetic Analyzer. The sequencing reagent was BigDye terminator v3.1. The primers used for sequencing were the same as those used for PCR amplification. The products of 2 independent amplification tubes for the 2 genes were completely sequenced on both strands to confirm the nucleotide sequences.

Examination of pork samples obtained from the posterior legs of the pig showed infection with the coiled intracellular Trichinella larvae. These pork samples were subsequently examined by the artificial digestion method, and the coiled and motile muscle larvae were collected with an intensity of infection of 12 larvae per gram of muscle tissues.

Multiplex PCR revealed amplicon of the expected size (173 bp) for T. spiralis in assays containing larval DNA from the Tibet Trichinella isolate from a naturally infected pig (Fig. 1).

Results of agarose gel electrophoresis with primers derived from 5S ISR and mt-lsrDNA using genomic DNA from different Trichinella isolates are shown in Fig. 2. Two DNA fragments (749 bp and 445 bp) of the Tibet Trichinella isolate were identical to that of the reference isolate of T. spiralis. The BLAST analysis with DNA sequences of the Tibet Trichinella isolate showed that 5S ISR DNA and mt-lsrDNA regions of the Tibet isolate most closely resembled those of T. spiralis sequences available in GenBank. Homologous analysis showed that the consistence of 5S ISR sequences of the Tibet Trichinella isolate and T. spiralis (accession number AY009946) was 100%; the consistency of mt-lsrDNA sequences of the Tibet Trichinella isolate and T. spiralis (accession number AY851277) was 99.75%, with just 1 nucleotide difference (53 A-G).