Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Original Article

DNA Extraction from Protozoan Oocysts/Cysts in Feces for Diagnostic PCR

The Korean Journal of Parasitology 2014;52(3):263-271.
Published online: June 26, 2014

1Department of Medical Parasitology, NLI, Menoufia University, Shebin El-Koom, Menoufia, Egypt.

2Department of Medical Laboratory Sciences, College of Applied Medical Sciences, Al-Taif University, Al-Taif, Saudi Arabia.

Corresponding author (yousryhawash@gmail.com)
• Received: October 12, 2013   • Revised: April 2, 2014   • Accepted: April 7, 2014

© 2014, Korean Society for Parasitology and Tropical Medicine

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 15,878 Views
  • 248 Download
  • 49 Web of Science
  • 46 Crossref
  • 56 Scopus
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Optimized DNA extraction from fecal samples using non-stool kits to improve PCR detection of protozoan parasites: A focus on Blastocystis sp.
    Asma Guilane, Bachir Medrouh, Houria Zait, Ikram Haleche, Amina Boutellis, Tahar Kernif
    Journal of Microbiological Methods.2026; 245: 107485.     CrossRef
  • Development of optimized DNA extraction protocols for the quantification of Eimeria spp. from chicken feces using real-time PCR
    Hye-Ri Jung, Moon Her, Chi Sun Yun, Jin-San Moon
    Poultry Science.2026; 105(8): 106971.     CrossRef
  • Evaluation of two PCR protocols for the detection of Entamoeba histolytica/E. dispar/E. moshkovskii in stool samples
    Rousneidy Mujica, Henry Trosel, Renzo Nino Incani, Jhon Jesús, Nayeska Méndez, María J. Perteguer, Elizabeth Ferrer
    Journal of Microbiological Methods.2026; 246: 107531.     CrossRef
  • Molecular characterization and zoonotic potential of Giardia and Cryptosporidium infections in dogs and cats in Central Spain
    Juan P. Barrera, Ana Montoya, Aida de Lucio, Pamela C. Köster, Begoña Bailo, David Carmena, Guadalupe Miró
    Food and Waterborne Parasitology.2026; 44: e00351.     CrossRef
  • Pre-Analytical Cleanup of Feline Feces Improves DNA Extract Quality, Reduces Post-Extraction PCR Inhibition, and Enhances Molecular Detectability of Intestinal Protozoa
    Dawid Jańczak, Aleksandra Kornelia Maj, Jakub Kędziorek, Mateusz Antecki
    Current Issues in Molecular Biology.2026; 48(7): 707.     CrossRef
  • Metagenomic detection of protozoan parasites on leafy greens aided by a rapid and efficient DNA extraction protocol
    Sohail Naushad, Ruimin Gao, Marc-Olivier Duceppe, Andree Ann Dupras, Sarah J. Reiling, Harriet Merks, Brent Dixon, Dele Ogunremi
    Frontiers in Microbiology.2025;[Epub]     CrossRef
  • Evidence of Waterborne Parasites in Mussels for Human Consumption Harvested from a Recreational and Highly Productive Bay
    Pilar Suarez, Italo Fernandez, José Luís Alonso, Gladys Vidal
    Microorganisms.2025; 13(9): 1971.     CrossRef
  • Molecular Detection of a Pathogenic Entamoeba among Symptomatic Children in Eastern Kurdistan of Iraq
    Sham Jamil Abdullah, Shahnaz Abdulkader Ali
    Polish Journal of Microbiology.2024; 73(1): 99.     CrossRef
  • Gut protozoa of wild rodents – a meta-analysis
    Simon Hunter-Barnett, Mark Viney
    Parasitology.2024; 151(6): 594.     CrossRef
  • Genetic diversity and occurrence of Eimeria species causing cattle coccidiosis in Kashmir, India
    Altaf Ahmad Reshi, Kamal Hashan Bulbul, Hidayatullah Tak, Zahoor Ahmad Wani, Idrees Mehraj Allaie, Abid Hussain Bhat
    Veterinary Parasitology: Regional Studies and Reports.2024; 52: 101056.     CrossRef
  • Multicenter comparative study of Enterocytozoon bieneusi DNA extraction methods from stool samples, and mechanical pretreatment protocols evaluation
    Céline Nourrisson, Maxime Moniot, Maxime Tressol, Céline Lambert, Emilie Fréalle, Florence Robert-Gangneux, Damien Costa, Louise Basmaciyan, Philippe Poirier
    Scientific Reports.2024;[Epub]     CrossRef
  • Evaluation of molecular-based methods for the detection and quantification of Cryptosporidium spp. in wastewater
    Oumaima Hachimi, Rebecca Falender, Gabriel Davis, Rispa Vranka Wafula, Melissa Sutton, June Bancroft, Paul Cieslak, Christine Kelly, Devrim Kaya, Tyler Radniecki
    Science of The Total Environment.2024; 947: 174219.     CrossRef
  • Nanoparticle Lysis of Cryptosporidium Oocysts
    Ameya Vaidya, Claire Bankier, Helinor Johnston, Helen Bridle
    Methods and Protocols.2024; 7(5): 66.     CrossRef
  • Enhancing diagnostic accuracy: Direct immunofluorescence assay as the gold standard for detecting Giardia duodenalis and Cryptosporidium spp. in canine and feline fecal samples
    Juan P. Barrera, Guadalupe Miró, David Carmena, Carlos Foncubierta, Juliana Sarquis, Valentina Marino, Efrén Estévez-Sánchez, Begoña Bailo, Rocío Checa, Ana Montoya
    BMC Veterinary Research.2024;[Epub]     CrossRef
  • Cryptosporidium spp. in German wildlife: Detection, regional occurrence and diversity in wild boar, roe, red and fallow deer
    Claudia Jäckel, Iryna Hrushetska, Anne Mayer-Scholl, Jens A. Hammerl, Annette Johne, Carl Gremse, Denny Maaz, Karsten Nöckler, Martin Heinrich Richter
    Heliyon.2024; 10(21): e38548.     CrossRef
  • Plastic pollution and fungal, protozoan, and helminth pathogens – A neglected environmental and public health issue?
    Michael J. Ormsby, Ayorinde Akinbobola, Richard S. Quilliam
    Science of The Total Environment.2023; 882: 163093.     CrossRef
  • Current Applications of Digital PCR in Veterinary Parasitology: An Overview
    Constantina N. Tsokana, Isaia Symeonidou, Georgios Sioutas, Athanasios I. Gelasakis, Elias Papadopoulos
    Parasitologia.2023; 3(3): 269.     CrossRef
  • A rapid multiplex loop-mediated isothermal amplification (mLAMP) assay for detection of Entamoeba histolytica and Giardia duodenalis
    Abhishek Mewara, Sandhya Khunger, Chayan Sharma, Sivanantham Krishnamoorthi, Shreya Singh, Rakesh Yadav, Sumeeta Khurana, Rakesh Sehgal
    Letters in Applied Microbiology.2023;[Epub]     CrossRef
  • An Epidemiological Assessment of Cryptosporidium and Giardia spp. Infection in Pet Animals from Taiwan
    Chia-Hui Hsu, Chi Liang, Shi-Chien Chi, Kuan-Ju Lee, Chung-Hsi Chou, Chen-Si Lin, Wen-Yuan Yang
    Animals.2023; 13(21): 3373.     CrossRef
  • Development and evaluation of a molecular based protocol for detection and quantification of Cryptosporidium spp. in wastewater
    N.P. Mthethwa, I.D. Amoah, P. Reddy, F. Bux, S. Kumari
    Experimental Parasitology.2022; 234: 108216.     CrossRef
  • Pampas fox (Lycalopex gymnocercus) of the Argentine Pampas as intermediate host for Neospora caninum
    Nathalia Paula Scioscia, Yanina Paola Hecker, David Arranz-Solís, Julieta Pedrana, Facundo Nahuel Urtizbiria, Lucía María Campero, Leandro Olmos, María V. Scioli, Matías A. Dorsch, Franco Fiorani, Felipe Cheuquepan, Guillermo María Denegri, Gastón Moré, D
    Parasitology International.2022; 88: 102549.     CrossRef
  • Comparison Study of Four Extraction Methods Combined with PCR and LAMP for Feline Tritrichomonas foetus Detection in Fecal Samples
    Joanna Dąbrowska, Jacek Karamon, Maciej Kochanowski, Jacek Sroka, Jolanta Zdybel, Tomasz Cencek
    Pathogens.2022; 11(5): 604.     CrossRef
  • Detection and Molecular Identification of Cryptosporidium Species Among Children with Malignancies
    Heba Said Ibrahim, Amel Youssef Shehab, Amal Farahat Allam, Mostafa Aboelhoda Mohamed, Hoda Fahmy Farag, Mona Mohamed Tolba
    Acta Parasitologica.2021; 66(2): 377.     CrossRef
  • Prevalence and Phylogenetic Analysis of Microsporidium Enterocytozoon bieneusi in Diarrheal Patients
    Manman Zang, Jinjin Li, Chun Tang, Songtao Ding, Wei Huang, Qizhong Qin, Handeng Liu
    Pathogens.2021; 10(2): 128.     CrossRef
  • Molecular detection of coccidian Apicomplexa Parasites isolated from wild crab-eating and pampas foxes through novel TaqMan™ probes: a contribution to their molecular epidemiology
    Natalia Mannise, Andrés Cabrera, Hernán Juan, Mariana Cosse, Federico Giannitti, María E. Francia, Telma González, Andrés Iriarte, Franklin Riet~Correa, Carlos Robello, Susana González
    Molecular Biology Reports.2021; 48(6): 5013.     CrossRef
  • Optimization of routine microscopic and molecular detection of parasitic protozoa in SAF-fixed faecal samples in Sweden
    Jessica Ögren, Olaf Dienus, Andreas Matussek
    Infectious Diseases.2020; 52(2): 87.     CrossRef
  • Evaluation of Different Oocyst DNA Extraction Methods for Cryptosporidium spp. Research in Environmental Samples
    Neliane Cristina Moreira, Marlene Cabrine-Santos, Márcia Benedita de Oliveira-Silva
    Acta Parasitologica.2020; 65(4): 995.     CrossRef
  • Simultaneous Detection of Ascaris lumbricoides, Trichuris trichiura and Strongyloides stercoralis using Modified Stool DNA Extraction Method
    Mehru Nisha, Pang Jyh Chyang, Jannah Arifin, Nurhannan Nadia, Amirul Fayyad, Fabian Davamani
    Research Journal of Parasitology.2020; 16(1): 1.     CrossRef
  • MULTIPLEX POLYMERASE CHAIN REACTION ASSAY FOR THE DETECTION OF FIVE COMMON ENDOPARASITE INFESTATIONS IN LABORATORY RODENTS
    Chien-Hao Chen, Ming-Hseng Wang, Cho-Hua Wan
    Taiwan Veterinary Journal.2020; 46(04): 123.     CrossRef
  • First report and molecular characterization of Cryptosporidium spp. in humans and animals in Khartoum state, Sudan
    Kaltoum Yagoub Adam, A. A. Ismail, M. A. Masri, A. A. Gameel
    Veterinary World.2019; 12(1): 183.     CrossRef
  • Use of shotgun metagenomics for the identification of protozoa in the gut microbiota of healthy individuals from worldwide populations with various industrialization levels
    Ana Lokmer, Amandine Cian, Alain Froment, Nausicaa Gantois, Eric Viscogliosi, Magali Chabé, Laure Ségurel, Tiffany L. Weir
    PLOS ONE.2019; 14(2): e0211139.     CrossRef
  • Zoonotic potential of Giardia lamblia and control of giardiasis
    Fantinatti* Maria
    Insights in Veterinary Science.2019; 3(1): 001.     CrossRef
  • Practical Guidance for Clinical Microbiology Laboratories: Laboratory Diagnosis of Parasites from the Gastrointestinal Tract
    Lynne S. Garcia, Michael Arrowood, Evelyne Kokoskin, Graeme P. Paltridge, Dylan R. Pillai, Gary W. Procop, Norbert Ryan, Robyn Y. Shimizu, Govinda Visvesvara
    Clinical Microbiology Reviews.2018;[Epub]     CrossRef
  • Assessment of the diagnostic performance of four methods for the detection of Giardia duodenalis in fecal samples from human, canine and feline carriers
    Flávia Fernandes de Mendonça Uchôa, Adriana Pittella Sudré, Sabrina Destri Emmerick Campos, Nádia Regina Pereira Almosny
    Journal of Microbiological Methods.2018; 145: 73.     CrossRef
  • Evaluation of Three Protocols of DNA Extraction for Detection of Giardia duodenalis in Human Fecal Specimens
    Fatemeh Asgarian, Mehdi Tavalla, Ali Teimoori, Nozhat Zebardast, Bahman Cheraghian
    Jundishapur Journal of Microbiology.2018;[Epub]     CrossRef
  • Evaluation of four commercial DNA extraction kits for the detection of Microsporidia and the importance of pretreatments in DNA isolation
    Ülfet Çetinkaya, Arzuv Charyyeva, Eda Sivcan, Esra Gürbüz
    Acta Parasitologica.2018; 63(2): 386.     CrossRef
  • Assessment of microscopic and molecular tools for the diagnosis and follow-up of cryptosporidiosis in patients at risk
    Y. Le Govic, K. Guyot, G. Certad, A. Deschildre, R. Novo, C. Mary, B. Sendid, E. Viscogliosi, L. Favennec, E. Dei-Cas, E. Fréalle, E. Dutoit
    European Journal of Clinical Microbiology & Infectious Diseases.2016; 35(1): 137.     CrossRef
  • Prevalence of intestinal parasite infections among patients in local public hospitals of Hail, Northwestern Saudi Arabia
    Omar Hassen Amer, Ibraheem M. Ashankyty, Najoua Al Sadok Haouas
    Asian Pacific Journal of Tropical Medicine.2016; 9(1): 44.     CrossRef
  • An Improved PCR-RFLP Assay for Detection and Genotyping of Asymptomatic Giardia lamblia Infection in a Resource-Poor Setting
    Yoursry Hawash, M. M. Ghonaim, S. S. Al-Shehri
    The Korean Journal of Parasitology.2016; 54(1): 1.     CrossRef
  • Recombinase polymerase amplification (RPA) combined with lateral flow (LF) strip for equipment-free detection of Cryptosporidium spp. oocysts in dairy cattle feces
    Yao-Dong Wu, Dong-Hui Zhou, Long-Xian Zhang, Wen-Bin Zheng, Jian-Gang Ma, Meng Wang, Xing-Quan Zhu, Min-Jun Xu
    Parasitology Research.2016; 115(9): 3551.     CrossRef
  • Evaluation of five commercial methods for the extraction and purification of DNA from human faecal samples for downstream molecular detection of the enteric protozoan parasites Cryptosporidium spp., Giardia duodenalis, and Entamoeba spp
    Silvia Paulos, Marta Mateo, Aida de Lucio, Marta Hernández-de Mingo, Begoña Bailo, José M. Saugar, Guillermo A. Cardona, Isabel Fuentes, María Mateo, David Carmena
    Journal of Microbiological Methods.2016; 127: 68.     CrossRef
  • Cryptosporidium as a testbed for single cell genome characterization of unicellular eukaryotes
    Karin Troell, Björn Hallström, Anna-Maria Divne, Cecilia Alsmark, Romanico Arrighi, Mikael Huss, Jessica Beser, Stefan Bertilsson
    BMC Genomics.2016;[Epub]     CrossRef
  • Performance of microscopy and ELISA for diagnosing Giardia duodenalis infection in different pediatric groups
    Renata K.N.R. Silva, Flávia T.F. Pacheco, Adson S. Martins, Joelma F. Menezes, Hugo Costa-Ribeiro, Tereza C.M. Ribeiro, Ângela P. Mattos, Ricardo R. Oliveira, Neci M. Soares, Márcia C.A. Teixeira
    Parasitology International.2016; 65(6): 635.     CrossRef
  • Clinical consequences of polymerase chain reaction‐based diagnosis of intestinal parasitic infections
    Lucas H Rijsman, Jan F Monkelbaan, Johannes G Kusters
    Journal of Gastroenterology and Hepatology.2016; 31(11): 1808.     CrossRef
  • Noninvasive Method of DNA Isolation From Fecal Epithelial Tissue of Dairy Animals
    Bidhan Chandra De, Mahesh Chandra Patra, Sushil Kumar, Biswajit Brahma, Devika Goutam, Latika Jaiswal, Ashutosh Sharma, Sachinandan De
    Animal Biotechnology.2015; 26(3): 211.     CrossRef
  • Prevalence of Cryptosporidium-Associated Diarrhea in a High Altitude-Community of Saudi Arabia Detected by Conventional and Molecular Methods
    Yousry Hawash, Laila Sh. Dorgham, Ayman S. Al-Hazmi, Mohammed S. Al-Ghamdi
    The Korean Journal of Parasitology.2014; 52(5): 479.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

DNA Extraction from Protozoan Oocysts/Cysts in Feces for Diagnostic PCR
Korean J Parasitol. 2014;52(3):263-271.   Published online June 26, 2014
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
DNA Extraction from Protozoan Oocysts/Cysts in Feces for Diagnostic PCR
Korean J Parasitol. 2014;52(3):263-271.   Published online June 26, 2014
Close

Figure

  • 0
  • 1
  • 2
DNA Extraction from Protozoan Oocysts/Cysts in Feces for Diagnostic PCR
Image Image Image
Fig. 1 Representative ethidium bromide-stained 1% agarose gel picture showing PCR amplification products of Cryptosporidium-positive feces subjected to different lysis temperatures and durations. Amplicons of cowp gene sequence (≈ 550 bp) were generated using Cry-9/Cry-15 primers. M, GeneRuler™ 100 bp DNA marker; Lane 1, PCR product of Cryptosporidium gDNA (Just for comparison); Lane 2, PCR product of DNA sample recovered from fecal aliquot subjected to lysis at 97℃ for 15 min; Lane 3, PCR product of DNA sample recovered from fecal aliquot subjected to lysis at 97℃ for 20 min; Lane 4, PCR product of DNA sample recovered from fecal aliquot subjected to lysis at 100℃ for 10 min; Lane 5, PCR product of DNA sample recovered from fecal aliquot subjected to lysis at 100℃ for 15 min; Lane x, Empty; Lane 6, Cryptosporidium-negative stool sample (extraction negative control); Lane 7, no-template master mix sample (PCR negative control); Lane 8, PCR product of DNA sample recovered from fecal aliquot subjected to lysis at 97℃ for 5 min as originally mentioned in the kit's protocol.
Fig. 2 Representative ethidium bromide-stained 2% agarose gel picture showing PCR amplification products of Cryptosporidium COWP gene sequence (≈ 550 bp) with primers Cry-9/Cry-15. Extracts of DNA were retrieved by the amended kit's protocol from 1 Cryptosporidium-positive fecal sample using 3 different approaches. M: GeneRuler™ 100 bp DNA marker; Lanes 1, 2, PCR products of 2 fecal aliquots subjected to direct DNA extraction; Lanes 3, 4, PCR products of 2 aliquots subjected to oocysts purification step prior to DNA extraction; Lane 5, A Cryptosporidium negative stool sample (extraction negative control). Lanes 6, 7, PCR products of two aliquots subjected to 6 freeze/thaw cycles prior to DNA extraction.
Fig. 3 Representative ethidium bromide-stained agarose gel pictures showing PCR amplification products of protozoan DNA extracts recovered from feces seeded with various counts of oocysts/cysts by the amended kit's protocol. Encircled amplicons were the lowest number of oocysts/cysts present per extract (i.e., 200 µl) and could be detected by PCR (i.e., the lower detection limits) (A) PCR amplification products of Cryptosporidium COWP gene sequence (≈ 550 bp) using primers Cry-9/Cry-15. (B) PCR amplification products of G. lamblia gdh gene sequence (≈ 450 bp) with primers GDHeF/GDHiR. (C) PCR amplification products of E. histolytica 18S rDNA gene sequence (≈ 170 bp) with primers EntaF/EhR. Lane 1, amplification product of DNA samples retrieved from 200 µl feces spiked with ≈ 1,700 oocysts/cysts; Lane 2, amplification product of DNA samples retrieved from 200 µl feces spiked with ≈ 1,500 oocysts/cysts; Lane 3, amplification product of DNA samples retrieved from 200 µl feces spiked with ≈ 1,000 oocysts/cysts; Lane 4, with ≈ 500 oocysts/cysts; Lane 5, amplification product of DNA samples retrieved from 200 µl feces spiked with ≈ 100 oocysts/cysts; Lane 6, amplification product of DNA samples retrieved from 200 µl feces spiked with ≈ 50 oocysts/cysts; Lane 7, amplification product of DNA samples retrieved from 200 µl feces spiked with ≈ 10 oocysts/cysts; M, GeneRuler™ 100 bp DNA marker.
DNA Extraction from Protozoan Oocysts/Cysts in Feces for Diagnostic PCR
Primer ID Sequence (5´-3´) Target gene Reference Cry-9 (F) GGACTGAAATACAGGCATTATCTTG Cryptosporidium COWP [27] Cry-15 (R) GTAGATAATGGAAGAGATTGTG Cryptosporidium COWP [27] XF1 (F) TTCTAGAGCTAATACATGCG Cryptosporidium 18S rDNA [30] XR1 (R) CCCTAATCCTTCGAAACAGGA Cryptosporidium 18S rDNA [30] XF2 (F) GGAAGGGTTGTATTTATTAGATAAAG Cryptosporidium 18S rDNA [30] XR2 (R) AAGGAGTAAGGAACAACCTCCA Cryptosporidium 18S rDNA [30] GDHeF (F) TCAACGTYAAYCGYGGYTTCCGT Giardia lamblia gdh [28]a GDHiR (R) GTTRTCCTTGCACATCTCC Giardia lamblia gdh [28]a GDHiF (nested) CAGTACAACTCYGCTCTCGG Giardia lamblia gdh [28]a RH11 (F) CAT CCG GTC GAT CCT GCC Giardia lamblia 18S rDNA [31] RH4 (R) AGTCGA ACC CTG ATTCTC CGCCAG G Giardia lamblia 18S rDNA [31] EntaF (F) ATGCACGAGAGCGAAAGCAT Entamoeba histolytica 18S rDNA [29] EhR (R) GATCTAGAAACAATGCTTCTCT Entamoeba histolytica 18S rDNA [29] E-1 (F) TAAGATGCACGAGAGCGAAA Entamoeba histolytica 18S rDNA [32] E-2 (R) GTACAAAGGGCAGGGACGTA Entamoeba histolytica 18S rDNA [32] EH-1 (F) AAGCATTGTTTCTAGATCTGAG Entamoeba histolytica 18S rDNA [32] EH-2 (R) AAGAGGTCTAACCGAAATTAG Entamoeba histolytica 18S rDNA [32] Bact-8F (F) AGAGTTTGATCCTGGCTCAG Broad range bacterial 16S [25]b 1391R (R) GACGGGCGGTGTGTRCA Broad range bacterial 16S [26]b
Table 1. Primers used in this study

(F) stands for forward, (R) stands for reverse, (COWP) for Cryptosporidium oocyst wall protein gene, and (gdh) Giardia lamblia glutamate dehydrogenase gene.

Primers with degenerate bases; ‘Y’ indicates a 50:50 mix of ‘C’ and ‘T’, while ‘R’ is an equivalent mix of ‘A’ and ‘G’ in the degenerate primer mixes produced.

Primer pairs was used early in the study to rule in or rule out PCR failure duo to the presence of impurities in DNA extracted from feces.