Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Original Article

Complete Mitochondrial Genome of Echinostoma hortense (Digenea: Echinostomatidae)

The Korean Journal of Parasitology 2016;54(2):173-179.
Published online: April 30, 2016

College of Animal Science and Veterinary Medicine, Heilongjiang Bayi Agricultural University, Daqing, Heilongjiang Province 163319, P. R. China

*Corresponding author (chunrenwang@sohu.com)

These authors contributed equally to this work.

• Received: August 5, 2015   • Revised: January 16, 2016   • Accepted: January 23, 2016

© 2016, Korean Society for Parasitology and Tropical Medicine

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 14,313 Views
  • 131 Download
  • 23 Web of Science
  • 21 Crossref
  • 25 Scopus
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Genetic variation and population structure of Haemonchus contortus: an in-silico analysis
    W. Wei, Z. Lan, Xuewei Liu, Xinhui Zhang, X. Gu, R. Wang
    Journal of Helminthology.2025;[Epub]     CrossRef
  • The Nuclear Ribosomal Transcription Units of Two Echinostomes and Their Taxonomic Implications for the Family Echinostomatidae
    Yu Cao, Ye Li, Zhong-Yan Gao, Bo-Tao Jiang
    Biology.2025; 14(8): 1101.     CrossRef
  • The complete mitochondrial genome of Aspidogaster ijimai (Platyhelminthes: Trematoda: Aspidogastrea): gene content and phylogenetic inference
    D. A. Solodovnik, D. M. Atopkin, A. A. Semenchenko, M. Urabe, S. G. Sokolov
    Invertebrate Zoology.2025; 22(3): 411.     CrossRef
  • Reassembly and improved annotation of the nearly complete mitochondrial genome of Echinostoma caproni (Digenea: Echinostomatidae) from an Egyptian isolate
    K. Cho, M. Kim, W.G. Yoo
    Journal of Helminthology.2025;[Epub]     CrossRef
  • Complete mitochondrial genome and phylogenetic analysis of Dollfustrema vaneyi (Trematoda: Bucephalidae)
    Ye Hu, Tong Ye, Hong Zou, Gui-Tang Wang, Wen-Xiang Li, Dong Zhang
    BMC Genomics.2024;[Epub]     CrossRef
  • Characterization of the complete mitochondrial genome of Plagiorchis multiglandularis (Digenea, Plagiorchiidae): Comparison with the members of Xiphidiatan species and phylogenetic implications
    Janelle Laura J. Gacad, Natalia I. Yurlova, Natalia M. Ponomareva, Misako Urabe
    Parasitology Research.2023; 122(7): 1545.     CrossRef
  • A report on the complete mitochondrial genome of the trematode Azygia robusta Odhner, 1911, its new definitive host from the Russian Far East, and unexpected phylogeny of Azygiidae within Digenea, as inferred from mitogenome sequences
    D. M. Atopkin, A. A. Semenchenko, D. A. Solodovnik, Y. I. Ivashko
    Journal of Helminthology.2023;[Epub]     CrossRef
  • The complete mitochondrial genome of Prosthogonimus cuneatus and Prosthogonimus pellucidus (Trematoda: Prosthogonimidae), their features and phylogenetic relationships in the superfamily Microphalloidea
    Xin-ru Guo, Ye Li, Yuan Gao, Yang-yuan Qiu, Zhen-hua Jin, Zhong-yan Gao, Xian-guang Zhang, Qi An, Qiao-cheng Chang, Jun-feng Gao, Chun-ren Wang
    Acta Tropica.2022; 232: 106469.     CrossRef
  • Characterization of complete mitochondrial genome and ribosomal operon forCarassotrema koreanumPark, 1938 (Digenea: Haploporidae) by means of next-generation sequencing data
    Y.I. Ivashko, A.A. Semenchenko, D.A. Solodovnik, D.M. Atopkin
    Journal of Helminthology.2022;[Epub]     CrossRef
  • Trematode diversity in freshwater snails from a stopover point for migratory waterfowls in Hokkaido, Japan: An assessment by molecular phylogenetic and population genetic analyses
    Minoru Nakao, Mizuki Sasaki
    Parasitology International.2021; 83: 102329.     CrossRef
  • First next-generation sequencing data for Haploporidae (Digenea: Haploporata): characterization of complete mitochondrial genome and ribosomal operon for Parasaccocoelium mugili Zhukov, 1971
    Dmitry M. Atopkin, Alexander A. Semenchenko, Daria A. Solodovnik, Yana I. Ivashko, Kirill A. Vinnikov
    Parasitology Research.2021; 120(6): 2037.     CrossRef
  • Characterization of the complete mitochondrial genome sequence of Tracheophilus cymbius (Digenea), the first representative from the family Cyclocoelidae
    Y. Li, X.X. Ma, Q.B. Lv, Y. Hu, H.Y. Qiu, Q.C. Chang, C.R. Wang
    Journal of Helminthology.2020;[Epub]     CrossRef
  • Mitochondrial Genome Sequence of Echinostoma revolutum from Red-Crowned Crane (Grus japonensis)
    Rongkun Ran, Qi Zhao, Asmaa M. I. Abuzeid, Yue Huang, Yunqiu Liu, Yongxiang Sun, Long He, Xiu Li, Jumei Liu, Guoqing Li
    The Korean Journal of Parasitology.2020; 58(1): 73.     CrossRef
  • Characterization and comparative analysis of the complete mitochondrial genome of Azygia hwangtsiyui Tsin, 1933 (Digenea), the first for a member of the family Azygiidae
    Yuan-An Wu, Jin-Wei Gao, Xiao-Fei Cheng, Min Xie, Xi-Ping Yuan, Dong Liu, Rui Song
    ZooKeys.2020; 945: 1.     CrossRef
  • Characterization of the complete mitochondrial genome of Diplostomum baeri
    Toby Landeryou, Stephen M. Kett, Anne Ropiquet, Dirk Wildeboer, Scott P. Lawton
    Parasitology International.2020; 79: 102166.     CrossRef
  • A fine‐scale phylogenetic assessment of digenean trematodes in central Alberta reveals we have yet to uncover their total diversity
    Michelle A. Gordy, Patrick C. Hanington
    Ecology and Evolution.2019; 9(6): 3153.     CrossRef
  • Characterization of the complete mitochondrial genome of Plagiorchis maculosus (Digenea, Plagiorchiidae), Representative of a taxonomically complex digenean family
    Suleman, Jun Ma, Mian Sayed Khan, Vasyl V. Tkach, Nehaz Muhammad, Dong Zhang, Xing-Quan Zhu
    Parasitology International.2019; 71: 99.     CrossRef
  • Characterization of the mitochondrial genome sequences of the liver fluke Amphimerus sp. (Trematoda: Opisthorchiidae) from Ecuador and phylogenetic implications
    Jun Ma, Jun-Jun He, Cheng-Yan Zhou, Miao-Miao Sun, William Cevallos, Hiromu Sugiyama, Xing-Quan Zhu, Manuel Calvopiña
    Acta Tropica.2019; 195: 90.     CrossRef
  • Characterization of the complete mitochondrial genome of Uvitellina sp., representative of the family Cyclocoelidae and phylogenetic implications
    Suleman, Mian Sayed Khan, Petr Heneberg, Cheng-Yan Zhou, Nehaz Muhammad, Xing-Quan Zhu, Jun Ma
    Parasitology Research.2019; 118(7): 2203.     CrossRef
  • The complete mitochondrial genome of Echinostoma miyagawai: Comparisons with closely related species and phylogenetic implications
    Ye Li, Yang-Yuan Qiu, Min-Hao Zeng, Pei-Wen Diao, Qiao-Cheng Chang, Yuan Gao, Yan Zhang, Chun-Ren Wang
    Infection, Genetics and Evolution.2019; 75: 103961.     CrossRef
  • Mitochondrial DNA Evidence Supports the Hypothesis that Triodontophorus Species Belong to Cyathostominae
    Yuan Gao, Yan Zhang, Xin Yang, Jian-Hua Qiu, Hong Duan, Wen-Wen Xu, Qiao-Cheng Chang, Chun-Ren Wang
    Frontiers in Microbiology.2017;[Epub]     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Complete Mitochondrial Genome of Echinostoma hortense (Digenea: Echinostomatidae)
Korean J Parasitol. 2016;54(2):173-179.   Published online April 30, 2016
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Complete Mitochondrial Genome of Echinostoma hortense (Digenea: Echinostomatidae)
Korean J Parasitol. 2016;54(2):173-179.   Published online April 30, 2016
Close

Figure

  • 0
  • 1
Complete Mitochondrial Genome of Echinostoma hortense (Digenea: Echinostomatidae)
Image Image
Fig. 1. Arrangement of the mitochondrial genome for Echinostoma hortense. Gene scaling is approximate only. All genes have standard nomenclature, including the 22 tRNA genes, which are designated by the one-letter code for the corresponding amino acid, with numerals differentiating each of the 2 leucine and serine specifying tRNAs (L1 and L2 for codon families CUN and UUR, respectively; S1 and S2 for codon families AGC and UCA, respectively).
Fig. 2. Phylogenetic relationship of Echinostoma hortense with other digenean trematodes based on mitochondrial genome sequence data. The concatenated amino acid sequences of 12 protein-coding genes were analyzed with maximum parsimony (MP) method, using Monogenean species Gyrodactylus thymalli (NC_009682) as the outgroup.
Complete Mitochondrial Genome of Echinostoma hortense (Digenea: Echinostomatidae)
Primer name Sequence of primer (5ʹ-3ʹ) Size (kb)
EH-1 F: AATATGCAAACACACCCGACTG ~3.8
R: CGATGTTGCGTTCTGTAGAGTCTAAGG
EH-2 F: GCCTCCTGTGTTTGTCTCTCGCTTTA ~2.2
R: CTCGCACCATATCCCAATTAGCC
EH-3 F: GGTTTATTACAGAGGTTT ~2.5
R: ATAACCATAGTAACAGAA
EH-4 F: TCTTGTTCTTGCTATGTTGGCTATT ~2.3
R: TTTAGCGGACCATCTCTTACAC
EH-5 F: AGCCAGGTCGGTTCTTATC ~1.4
R: ACCACACAACTCCGTACAATAAC
EH-6 F: CGTTAGGGTGTGTCCAACTGT ~1.7
R: AGCAACAATCTTCTTTAAGTCCATA
EH-7 F: GTGGGAGTATTTAGGTCTTGTCAGG ~4.7
R: GAACACCACTAGAATAAGGAATTAC
Gene/Region Positions
No. of
Codons
Start (5') End (3') Nucleotides Aminoacids Initiation Termination
cox3 1 630 630 209 ATG TAA
tRNA-His 652 716 65
cytb 718 1,791 1,074 357 ATG TAG
nad4L 1,802 2,089 288 95 GTG TAA
nad4 2,050 3,297 1,248 415 ATG TAA
tRNA-Gln 3,342 3,403 62
tRNA-Phe 3,408 3,471 64
tRNA-Met 3,475 3,539 65
atp6 3,540 4,055 516 171 GTG TAG
nad2 4,066 4,935 870 289 ATG TAA
tRNA-Val 4,939 5,001 63
tRNA-Ala 5,032 5,096 65
tRNA-Asp 5,100 5,162 63
nad1 5,158 6,057 900 299 ATG TAG
tRNA-Asn 6,063 6,129 67
tRNA-Pro 6,134 6,196 63
tRNA-Ile 6,200 6,261 62
tRNA-Lys 6,267 6,332 66
nad3 6,340 6,696 357 118 ATG TAG
tRNA-SerAGC 6,704 6,762 59
tRNA-Trp 6,771 6,838 68
cox1 6,842 8,383 1,542 513 GTG TAA
tRNA-Thr 8,409 8,473 65
rrnL 8,474 9,446 973
tRNA-Cys 9,447 9,506 60
rrnS 9,507 10,265 759
cox2 10,266 10,865 600 199 ATG TAG
nad6 10,948 11,397 450 149 ATG TAA
tRNA-Tyr 11,399 11,462 64
tRNA-LeuCUA 11,463 11,525 63
tRNA-SerUCA 11,526 11,587 62
tRNA-LeuUUA 11,593 11,656 64
tRNA-Arg 11,655 11,719 65
nad5 11,722 13,293 1,572 523 GTG TAA
tRNA-Gly 13,304 13,370 67
tRNA-Glu 13,373 13,441 69
NC (64.58%) 13,442 14,994 1,553
Table 1. Sequences of primers used to amplify PCR fragments of mitochondrial genome from Echinostoma hortense
Table 2. The organization of mitochondrial genome of Echinostoma hortense