Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Brief Communication

Loop-Mediated Isothermal Amplification Targeting Actin DNA of Trichomonas vaginalis

The Korean Journal of Parasitology 2016;54(3):329-334.
Published online: June 30, 2016

1Department of Parasitology and Tropical Medicine, Kyungpook National University School of Medicine, Daegu 41944, Korea

2Department of Obstetrics and Gynecology, Shinsegae Women’s Hospital, Daegu 41535, Korea

3Department of Environmental Biology & Medical Parasitology, Hanyang University College of Medicine, Seoul 04763, Korea

4Department of Parasitology, Dong-A University College of Medicine, Busan 49201, Korea

5Center of Biostatistics, Kyungpook National University School of Medicine, Daegu 41944, Korea

* Corresponding author (ychong@knu.ac.kr)
• Received: March 20, 2016   • Revised: April 10, 2016   • Accepted: April 16, 2016

© 2016, Korean Society for Parasitology and Tropical Medicine

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 10,784 Views
  • 196 Download
  • 15 Web of Science
  • 14 Crossref
  • 15 Scopus
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Loop‐Mediated Isothermal Amplification (LAMP) for the Diagnosis of Sexually Transmitted Infections: A Review
    Yasaman Ahmadi, Yejiong Yu, Zhanfeng Cui, Wei E. Huang, Monique I. Andersson
    Microbial Biotechnology.2025;[Epub]     CrossRef
  • A novel detection method based on MIRA-CRISPR/Cas13a-LFD targeting the repeated DNA sequence of Trichomonas vaginalis
    Zhenke Yang, Jinghui Wang, Yiming Qi, Yiping Shi, Fakun Li, Weijuan Wang, Xiaowei Tian, Xuefang Mei, Zhenchao Zhang, Shuai Wang
    Parasites & Vectors.2024;[Epub]     CrossRef
  • A novel fluoro colorimetric Loop mediated isothermal amplification (LAMP) assay for detection of Trichomonas vaginalis
    Shoorashetty Manohar Rudresh, Pareyam Pooja, Pattacheravanda Nanaiah Shakuntala, Kanta Madhu
    Indian Journal of Medical Microbiology.2024; 49: 100610.     CrossRef
  • Establishment of a programmatic detection method for Trichomonas vaginalis based on double antibody sandwich ELISA targeting TvCP39 antigen
    Yuhua Li, Fakun Li, Wenjie Tian, Yani Zhang, Weijuan Wang, Zhenke Yang, Xiaowei Tian, Shuai Wang, Xuefang Mei, Zhenchao Zhang
    Acta Tropica.2024; 260: 107489.     CrossRef
  • Label-free electrochemical DNA biosensing of MR TV 29 18s ribosomal RNA gene of Trichomonas vaginalis by signalization of non-spherical gold nanoparticles
    R. Dehdari Vais, H. Heli, N. Sattarahmady
    Materials Today Communications.2023; 34: 105123.     CrossRef
  • Construction a novel detection method for Trichomonas vaginalis based on recombinant enzyme polymerase amplification targeting the Actin gene
    Fakun Li, Yangyang Deng, Wanxin Sheng, Xihui Gao, Weijuan Wang, Zhili Chu, Xuefang Mei, Zhenke Yang, Xiaowei Tian, Shuai Wang, Zhenchao Zhang
    Journal of Eukaryotic Microbiology.2023;[Epub]     CrossRef
  • A novel and ultrasensitive label-free electrochemical DNA biosensor for Trichomonas vaginalis detection based on a nanostructured film of poly(ortho-aminophenol)
    Rezvan Dehdari Vais, Hossein Heli, Naghmeh Sattarahmady, Afshin Barazesh
    Synthetic Metals.2022; 287: 117082.     CrossRef
  • Omics Analyses of Trichomonas vaginalis Actin and Tubulin and Their Participation in Intercellular Interactions and Cytokinesis
    Sebastián Lorenzo-Benito, Luis Alberto Rivera-Rivas, Lizbeth Sánchez-Ayala, Jaime Ortega-López, Octavio Montes-Flores, Daniel Talamás-Lara, Rossana Arroyo
    Genes.2022; 13(6): 1067.     CrossRef
  • Photo-genosensor for Trichomonas vaginalis based on gold nanoparticles-genomic DNA
    S. Ilbeigi, R. Dehdari Vais, N. Sattarahmady
    Photodiagnosis and Photodynamic Therapy.2021; 34: 102290.     CrossRef
  • Loop mediated isothermal amplification assay for detection of Trichomonas vaginalis in vaginal swabs among symptomatic women from North India
    S. Khurana, R. Dadwal, N. Sharma, A. Mewara, S. Singh, R. Bagga, R. Yadav, S. Sethi
    Letters in Applied Microbiology.2020; 70(3): 196.     CrossRef
  • Establishment and application of isothermal amplification techniques for the detection of heat-stable I enterotoxin of enterotoxigenic Escherichia coli
    Junjun Zhai, Zhang Yan, Feng Ping, Qu Lei, Xuelong Chen, Yanping Qi, Tianwen Wang
    PLOS ONE.2020; 15(4): e0230881.     CrossRef
  • Development of a convenient detection method for Trichomonas vaginalis based on loop-mediated isothermal amplification targeting adhesion protein 65
    Yuhua Li, Shuai Wang, Haoran Li, Xiaoxiao Song, Hao Zhang, Yujuan Duan, Chengyang Luo, Bingli Wang, Sifan Ji, Qing Xie, Zhenchao Zhang
    BMC Infectious Diseases.2020;[Epub]     CrossRef
  • Label-free ultrasensitive electrochemical genosensing of Trichomonas vaginalis using anisotropic-shaped gold nanoparticles as a platform, a repeated sequence of the parasite DNA as a probe, and toluidine blue as a redox marker
    N. Delshadi-Jahromi, R. Nazari-Vanani, H. Yadegari, N. Sattarahmady, G.R. Hatam, H. Heli
    Sensors and Actuators B: Chemical.2018; 273: 234.     CrossRef
  • Real-time loop-mediated isothermal amplification for rapid detection of Enterocytozoon hepatopenaei
    Shao-Xin Cai, Fan-De Kong, Shu-Fei Xu, Cui-Luan Yao
    PeerJ.2018; 6: e5993.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Loop-Mediated Isothermal Amplification Targeting Actin DNA of Trichomonas vaginalis
Korean J Parasitol. 2016;54(3):329-334.   Published online June 30, 2016
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Loop-Mediated Isothermal Amplification Targeting Actin DNA of Trichomonas vaginalis
Korean J Parasitol. 2016;54(3):329-334.   Published online June 30, 2016
Close

Figure

  • 0
Loop-Mediated Isothermal Amplification Targeting Actin DNA of Trichomonas vaginalis
Image
Fig. 1. Functionality of T. vaginalis actin LAMP assays. (A) LAMP on 10-fold serial dilutions of T. vaginalis genomic DNA (10 ng to 1 pg per reaction) monitored by measuring absorbance. Distilled water was used as a negative control. (B) LAMP products were visualized by gel electrophoresis. Lane 1, 1 ng; lane 2, 100 pg; lane 3, 10 pg; lane 4, 1 pg of T. vaginalis genomic DNA; lane 5, LAMP product after HindIII digestion; lane 6, distilled water; lane M, 100-bp DNA marker. (C) LAMP products were visualized under UV light using the Loopamp fluorescent detection reagent. Lane 1, 1 ng; lane 2, 100 pg; lane 3, 10 pg; lane 4, 1 pg; lane 5, 100 fg; lane 6, 10 fg of T. vaginalis genomic DNA; lane 7, distilled water. (D-E) T. vaginalis at a density of 1×102 parasites/μl was serially diluted and tested using the LAMP assay (D) and PCR (E) with F3 and B3 primers (Table 1). Lane M, 100-bp DNA marker; lane 1, 100; lane 2, 10; lane 3, 1; lane 4, 0.1; lane 5, 0.01 parasite(s) per reaction; lane 6, positive control, 100 pg of plasmid DNA containing the LAMP targeting regions of actin gene; lane 7, distilled water. (F) Specificity of LAMP primers for detection of T. vaginalis assessed using template DNA from other microbial species. Lane 1, T. vaginalis; lane 2, Candida albicans; lane 3, Chlamydia trachomatis; lane 4, Neisseria gonorrhoeae; lane 5, Cryptosporidium parvum; lane 6, Entamoeba histolytica; lane 7, Giardia lamblia; lane 8, Escherichia coli; lane 9, human genomic DNA. LAMP products were visualized by a color change that was also observable by the naked eye under normal visible light.
Loop-Mediated Isothermal Amplification Targeting Actin DNA of Trichomonas vaginalis
Primer Sequence (5ʹ→3ʹ)
F3 GCTTCTCACAGAGCGTGG
B3 GCTCATTGCCGATTGTGATG
FIP AGGGCGACATAGCAAAGCTTCTGCTTTCAACACAACAGCCG
BIP TGCTGAAATGGAGAAGGCCGCCGTTGCCATCTGGAAGTGTG
LF CTTGATGTCACGAACGATTTCCTTT
LB TACAGACTCCTCCATCAACGT
Assay No. positive Sensitivity (95% CI) Specificity (95% CI) PPV (95% CI) NPV (95% CI) Kappa
Microscopy 12 30 (17.1-46.7) 100 (65.5-100) 100 (69.9-100) 26.3 (13.9-43.4) 0.146 (0.037-0.256)
Multiplex PCR 23 57.5 (41.0-72.6) 100 (65.5-100) 100 (82.2-100) 37 (20.1-63.2) 0.351 (0.161-0.542)
PCR 40
LAMP 43 100 (89.1-100) 70 (35.4-91.9) 93 (79.9-98.2) 100 (56.1-100) 0.789 (0.562-1)
Table 1. Primer sequences for T. vaginalis actin LAMP
Table 2. Comparison of diagnostic methods among T. vaginalis detection (n=50)

Sensitivity and specificity of the tests were determined using the PCR results as gold standard.

PPV, positive predictive value; NPV, negative predictive value; CI, confidence interval.