P. falciparum 3D7 (ATCC PRA-405D) was purchased from American Type Culture Collection (ATCC, Manassas, Virginia, USA). P. vivax-infected patient blood samples were collected from endemic areas, and healthy individual samples were collected from malaria-free areas of Gangwon-do (Province), Korea. The study was approved by the Kangwon National University Hospital Institutional Review Board (approval no. 2014-08-008-002).

P. falciparum 3D7 was continuously cultured in RPMI 1,640 medium (24 mM sodium bicarbonate, 25 μg/ml gentamicin, 1% albumax, 0.05% hypoxanthine, and 1% penicillin) with 5% hematocrit of type O human red blood cells. The quantitative parasite content in the blood (parasitemia) was checked daily by Giemsa staining (Polysciences, Inc., Warrington, Pittsburg, USA). The medium was changed daily and divided when parasitemia reached 5–6%. The culture plates were maintained at 37°C with 5% CO₂, 5% O₂, and 90% N₂ atmosphere.

The LDH sequences of P. vivax (GenBank no. DQ060151.1) and P. falciparum (GenBank no. XM_001349953.1) were amplified by PCR (Takara, Kusatsu, Japan) using primer pairs: Forward 5′-C ATATGACGCCGAAACCCAAA–3′ (NdeI restriction site), Reverse 5′-GGAGCTCGAAATGAGCGCCT-3′ (SacI restriction site) for PvLDH expression and Forward 5′-AGCTAGCATGGCACCAAAAGCAAAAATCGT-3′ (NheI restriction site), Reverse 5′-GGAGCTCGAAGCTAATGCCTTCATTCTCTTAGT-3′ (SacI restriction site) for PfLDH expression. PCR products were confirmed by electrophoresis and purified using a quick gel extraction kit (Qiagen, Germantown, Maryland, USA). The purified products were cloned in p-GEM-T Easy vector (Promega, Madison, Wisconsin, USA) for transformation and culture. Positive clones were extracted and confirmed by sequencing. The expected DNA sequence was ligated into pET-21b vector (Novagen, Sydney, Australia) for expression. Isopropyl β-D-1-thiogalactopyranoside (IPTG) (0.5 mM) was used to induce antigen expression and after 4 hr of culturing, cell lysates were harvested for analysis of antigen expression.

Recombinant antigen was obtained by native condition using Tris buffer (100 mM NaCl, 50 mM Tris HCl, 5% glycerol, pH 7.5) and purified further. Briefly, the supernatant was incubated with Ni-NTA agarose (Qiagen) at 10 mM imidazole at room temperature for 30 min. Bound proteins were obtained with an elution buffer containing imidazole at concentrations of 50 mM, 100 mM, and 300 mM and then analyzed by 12% SDS-PAGE. For western blotting, the purified proteins were loaded onto 12% SDS-PAGE gels at 3 μg per lane and then transferred to polyvinylidene difluoride (PVDF) membrane (Thermo Fisher Scientific Inc., Waltham, Massachusetts, USA). PBS with 0.1% Tween 20 (PBST) and 5% skim milk was used for blocking. The primary antibody was a 6×His-tag antibody (Thermos Fisher Scientific Inc.) diluted 12,000 folds. The secondary antibody was a rabbit polyclonal antibody to mouse IgG–horseradish peroxidase (anti-mouse HRP) (Abcam, Cambridge, UK) diluted 30,000 folds. The results were imaged by ChemiDoc XRS+ imaging system (Bio-Rad, Hercules, California, USA).

Monoclonal antibodies were generated by immunizing mice. For the first injection, the recombinant PvLDH and PfLDH proteins (each 50 μg per 100 μl) were mixed with an equal volume of Freund’s complete adjuvant (Sigma-Aldrich, St. Louis, Missouri, USA) and injected intraperitoneally into 7-week-old female BALB/c mice (Daehan Bio-Link Ltd., Eumseong, Chungcheongbuk-do, Korea). Then, the rPvLDH and rPfLDH proteins (each 25 μg per 100 μl) mixed with an equal volume of Freund’s incomplete adjuvant were boosted biweekly. After the third injection, a final injection of rPvLDH and rPfLDH proteins without adjuvant (each 5 μg per 100 μl) was administered intravenously. The cell fusion technique was performed according to previously established protocols [9,10]. Briefly, mouse splenocytes were fused with myeloma cell line FO obtained from the ATCC by adding 50% polyethylene glycol (Sigma-Aldrich) and then seeded in each well of a 96-well culture plate. Hybridoma cells were selected by subculture in HAT (hypoxanthine, aminopterin, and thymidine) and HT (hypoxanthine and thymidine) media, and the antibody formation was screened by ELISA. Hybridoma cells producing a mAb were selected, scaled up, and subjected to limiting dilution for the production of monoclones producing mAbs. Selected monoclonal cells were intraperitoneally injected into 10-week-old female BALB/c mice for large-scale mAb production. The mAbs obtained from mouse ascites were purified using a Protein A agarose column (Amersham Biosciences, Uppsala, Sweden) and confirmed by SDS-PAGE and western blotting.

Western blotting for candidate antibodies was performed with a 6×His-tag antibody. Recombinant protein (3 μg) was separated by SDS-PAGE gel and then transferred to PVDF membrane. After blocking the membrane with 5% skim milk in PBST, monoclonal 2CF5 and 1G10 antibodies were applied to the membrane (30 μg) as the primary antibody. The reaction of the antigen and primary antibody was recognized by anti-mouse HRP in diluted 1:30,000 folds. The result was imaged by ChemiDoc XRS+ imaging system.

Indirect ELISA with parasites was performed with P. falciparum 3D7 in vitro cultures at 10⁶ parasites/ml, using 96-well microtiter plates (SungwooLS, Uijeongbu-si, Gyeonggi-do, Korea), followed by overnight incubation at 4°C. The plate was washed by addition of 200 μl PBST per well with gentle shaking for 2 min (3 times) and then blocked with blocking buffer (4% BSA dissolved in PBST). 2CF5 and 1G10 mAb (5 μg per 100 μl) were added to each well as the primary antibody. After incubation for 1.5 hr at 37°C, the plate was washed 3 times and incubated with anti-mouse HRP (Abcam, Bristol, UK) (1: 5,000) for 1 hr. Color was developed using 3,3′,5,5′-Tetramethylbenzidine (TMB) substrate (Thermo Fisher Scientific Inc.) and stopped with 0.18 M H₂SO₄. The absorbance was then read at 450 nm using an Infinite F200 microplate reader (TECAN, Männedorf, Switzerland).

The in vitro-cultured P. falciparum was used to make a thin smear on a microscope slide for Giemsa staining and immunofluorescence assay (IFA). For IFA, cells were fixed with 4% paraformaldehyde, followed by PBST washing and then incubated in PBS with 0.1% Triton X-100 for 40 min. The slide was blocked with 2% BSA for 2 hr. Subsequently, 2CF5 and 1G10 mAbs were added with overnight incubation at 4°C. After washing, anti-mouse IgG FITC (Sigma-Aldrich) was added (5,000-fold dilutions), and slides were incubated at room temperature for 1 hr. After washing, slides were dried and mounted with DAPI-containing mounting medium (Vector Lab, Burlingame, California, USA). Fluorescence was captured with an Olympus Fluoview FV1000 confocal laser scanning microscope (Tokyo, Japan).

Sandwich ELISA was performed to determine the specificity of the selected mAbs. For this test, 1G10 mAb was conjugated with HRP using EZ-Link Plus Activated Peroxidase Kit (Thermo Scientific Inc.). Each well of a microtiter plate was coated with 0.1 μg of the 2CF5 mAb with overnight incubation. After 1 day, the plate was washed with PBST and blocked with 4% BSA in PBST for 2 hr, followed by a wash step and addition of a serial dilution of analytes (PvLDH antigen, P. falciparum 3D7, and P. vivax-infected patient blood) to the wells. After 1 hr incubation, the plate was washed, and 1G10 mAb conjugated HRP was added at 0.1 μg per well. An hour later, color was developed using TMB substrate and stopped by 0.18 M H₂SO₄. Absorbance at 450 nm was then read on a microplate reader.

All results were statistically analyzed using GraphPad Prism 5.0. One-way analysis of variance (ANOVA) was used to analyze ELISA data using of Tukey’s multiple comparisons. All data are shown as means±SD of biological replicates.

P. vivax LDH showed 90% sequence identity with that of P. falciparum. In addition, it had high identity with P. berghei and P. malariae, being 90–91% identical. The highest homology was to P. knowlesi and P. ovale, up to 97–99%. Sequence homology between P. vivax and other species of Plasmodium genus (P. yoelii and P. reichenowi) was also significant (90%). In contrast, the amino acid identity of P. vivax was low in Toxoplasma gondii or Homo sapiens, showing 51% and 32%, respectively. The sequences of all species were obtained from the NCBI (Fig. 1A). Antigen expression of PfLDH and PvLDH was obtained in the soluble fraction in Escherichia coli, showing dominant expression at 35.2 kDa (Fig. 1B). The purified proteins were confirmed by western blot (Fig. 1C).

After antibody formation was observed in mice post-immunization (Fig. 2A), cell fusion and limiting dilutions were performed, and then 8 monoclones, namely, 1BD6-AG5, 2AD8-C7, 2CF1-AD10, 2CF1-DA4, 2CF1-AG4, 2CF1-BF5 (2CF5), 3CH2-BB7, and 5DC3-BA5 for rPvLDH (left), and 7 monoclones (1B5, 1G11, 1B9, 1E6, 1C5, 1G10, and 1G5) for PfLDH (right) were produced (Fig. 2A). The final selected monoclonal antibodies, 2CF5 for PvLDH and 1G10 for PfLDH, were purified and identified by SDS-PAGE, which showed the immunoglobulin heavy and light chains (Fig. 2B). The interaction of selected mAbs against recombinant antigens was determined by western blotting (Fig. 2C). Each mAb was tested for PfLDH and PvLDH, and the affinity between PvLDH and 2CF5 was stronger than that of PfLDH and 2CF5. 1G10 recognized both antigens aggressively (Fig. 2D).

The reactivity of antigen and antibody was confirmed by IFA using the trophozoite and schizont stages of P. falciparum according to Giemsa staining resulting (Fig. 3A). Infected erythrocytes were fixed on glass slides, and 2 candidate antibodies were applied separately. The results showed that there was no fluorescence visible with the 2CF5 mAb (Fig. 3B), implying that it could discriminate between Plasmodium species. In contrast, positive fluorescence was captured from the 1G10 mAb and detected well in trophozoites and schizonts with a higher resolving power (Fig. 3B, bottom panel).

The non-reactivity of 2CF5 mAb to P. falciparum was confirmed by indirect ELISA. The 1G10 mAb showed a positive reaction at 10⁶ parasites/ml, but 2CF5 did not detect P. falciparum (Fig. 4A). Therefore, in the sandwich ELISA, the 1G10 mAb was used as the detection antibody, and the 2CF5 Pv-LDH mAb was used as the capturing antibody. 1E6 and 1G10 were used as a pair of positive control antibodies to detect P. falciparum. Both normal blood and infected blood showed similar OD values for the 2CF5-1G10 pair (0.161±0.001 and 0.177±0.002, respectively). In contrast, the 1E6-1G10 antibody pair showed a positive value of 10⁵ parasites (0.298±0.015) in comparison to the normal blood sample (0.198±0.01) (Fig. 4A).

The limit of blank (LoB) and limit of detection (LoD) of the 2CF5-1G10 antibody pair was determined in a sandwich ELISA with serial dilution of PvLDH. The LoB and LoD was defined based on a previous study [11]. The OD 450 nm illustrated the limited of blank (LoB) was 0.055, and the LoD was determined as 0.059. According to OD value of LoD 2CF5 and 1G10 antibody pair was able to detect 31.25 ng/ml of PvLDH (Fig. 4B). The sandwich ELISA was used to determine if it could distingush P. falciparum and P. vivax using serial dilution of in vitro-cultured P. falciparum and P. vivax-infected patient bloods. First of all, the pair of 2CF5 and 1G10 antibody was not able to detect P. falciparum in the range of 10⁶ parasites/ml which was detected positively by a pair of positive control mAbs (1E6-1G10) for P. falciparum (Fig. 4C).

A sandwich ELISA was performed for detection in patient blood infected with P. vivax. The 2CF5-1G10 antibody pair was determined as a positive antibody pair for P. vivax because OD values of all patients (n=7) were higher than those of negative bloods (n=7) (Fig. 4D). Therefore, the pair of those antibodies could discriminate P. falciparum and P. vivax.