A cross-sectional study was conducted in kennels located in the municipalities of Canoas (latitude 29°55′8″ and longitude 51°10′41″), São Leopoldo (latitude 29°45′39″ and longitude 51°9′8″), and Novo Hamburgo (latitude 29°41′5″ and longitude 51°8′31″), which integrate the Metropolitan region of the state’s Capital City, Porto Alegre. Canoas and Novo Hamburgo kennel is located in urban areas, while São Leopoldo kennel is located in an area that contains both urban and rural residences, with lush vegetation, which characterizes a transition area. The sample size was calculated based on previous data reporting the prevalence of CVL in Porto Alegre (4.1%) [12], setting a total of 378 dogs. The present study evaluated 405 mongrel dogs characterized according to sex, race, coat type, and reproductive capabilities and underwent a careful clinical evaluation by veterinarians. The exclusion criteria covered puppies (<1 year of age), aggressive dogs, and those immunized against CVL. This study was approved by the Animals Ethics Committee of the University (UFCSPA), under reference no. 118/13 and followed the STROBE guidelines.

From January to July 2014, blood samples from 405 dogs from the municipalities of Canoas (n=107), São Leopoldo (n=216), and Novo Hamburgo (n=82) were collected using jugular or cephalic venipuncture. Portions of each blood sample were transferred to tubes with and without EDTA, centrifuged at 2,000 rpm for 10 min, and plasma and serum aliquots were kept at −80°C until serological analysis.

All 405 dogs were analyzed using immunochromatographic and ELISA assays. To obtain specimens for parasitological tests (smears and parasite culture), aspiration biopsy from the lymph nodes and peripheral blood samples were obtained from animals with positive or undetermined results in serological tests. An equal number of the dogs (matched for age and sex) with negative test (in both serological methods) were used as negative control. To evaluate possible cross-reactivity with other parasitic diseases in serological methods (false-positives) or co-infections, a SNAP 4DX Plus (IDEXX Laboratories, Westbrook, Maine, USA) was conducted with samples that were either positive or with a suspicion of CVL in sorology. In order to confirm Leishmania infection, all samples that had a positive or undetermined result in one or both serological tests were evaluated by real-time PCR. In addition, samples positive to Anaplasma in the SNAP 4DX Plus (IDEXX Laboratories) were tested by quantitative real-time PCR to confirm or rule out the presence of Anaplasma or Ehrlichia. The experimental protocol is represented in Fig. 1.

Dual Path Platform (DPP®) (Bio-Manguinhos, Fiocruz, Brazil) is a rapid test based on recombinant chimeric protein (rk28) obtained from fusion of L. infantum genes that has been adopted by the Brazilian Ministry of Health for CVL diagnosis as screening test. Plasma from a symptomatic dog previously identified as positive for Leishmania infection using DPP, ELISA, and parasitological tests was used as positive control.

The ELISA EIE® assay (Bio-Manguinhos) has been used since 2012 in Brazil as a means to confirm DPP results. This assay was performed according to the manufacturer’s instructions. Serum samples from all dogs (n=405) were tested, and samples classified as positive or undetermined in ELISA and/or in DPP were retested by ELISA using both serum and plasma matrices. Plasma from a symptomatic dog with positive serological (DPP and ELISA) and parasitological tests was used as positive control.

The DNA was isolated from 200 μl of plasma using the commercial Nucleic Acid and Protein Purification kit (Macherey-Nagel, Düren, Germany), according to the manufacturer’s instructions. DNA was resuspended in 30 μl of the kit elution buffer and was stored in −20°C until use. The primers 13A (5′-GTG GGG GAG GGG CGT TCT-3′) and 13B (5′-ATT TTA CAC CAA CCC CCA GTT-3′), as described by Rodgers et al. [13] were used to amplify the DNA. The amplification targeted 120 base pair regions of the kinetoplast DNA (kDNA) minicircles of the genus Leishmania, which are present in multiple copies in a conserved region of the kDNA. The real-time PCR amplification was conducted in a StepOne^TM real-time PCR System (Applied Byosystems, Foster City, California, USA) and the amplified products were detected using a SYBR® Green system (Applied Biosystems). The reaction was standardized in a final volume of 20 μl containing 15 μl of the Fast SYBR® Green mastermix, 10 pmol of each primer and 5 μl of the extracted DNA. The amplification conditions were activation of the enzyme at 95°C for 20 sec, and 40 cycles of denaturation at 95°C for 1 sec, and annealing/ extension at 61°C for 20 sec. The amplification and dissociation curves were analyzed in the StepOne^TM equipment software (Fig. 2). The sample was defined as positive when it had a detectable cycle threshold (Ct) and the melting temperature (Tm) was the same as for positive control. To access for the presence of inhibitors, all samples that tested negative in PCR were spiked with human DNA and amplified with the β-globin primers PCO3 (5′ACACAACTGTGTTCACTAGC3′) and PCO4 (5′CAACTTCATCCACGTTCACC3′) [14]. A negative reaction control (PCR mixture containing ultrapure water) was used for each amplification run, with a positive control that consisted of purified L. (L). amazonensis DNA (MHOM/BR/73/M2269 strain). All plasma samples and controls were run in duplicate.

In order to perform cytological examinations, samples from either mandibular, cervical, or popliteal lymph node were obtained by aspiration. A tissue smear of the lymph node cells was stained with fast panoptic (Laborclin, Pinhais, Paraná, Brazil) and direct amastigote presence was investigated at 100× magnification (Olympus CX 22LED, Tokyo, Japan).

Lymph node and white blood cells (buffy-coat) samples were inoculated in M199 or Schneider’s medium supplemented with 20% fetal bovine serum, 2% human urine, 10 U/ml penicillin and 10 mg/ml streptomycin. Cultures were incubated at 26°C in a BOD incubator for allow Leishmania growth [15] and Leishmania cultures were inspected for the presence of promastigotes weekly under an inverted microscope for up to 4 weeks.

Twenty-one plasma samples that were considered Leishmania-positive or undetermined in DPP, ELISA, or both methods were tested on the SNAP 4DX Plus (Idexx Laboratories) according to the manufacturer’s instructions. SNAP 4DX Plus detects Dirofilaria immitis antigens and antibodies against Anaplasma phagocytophilum, Anaplasma platys, Borrelia burgdorferi, and Erlichia canis in serum, plasma or whole blood canine samples.

The qPCR-HRM was performed to confirm or rule out the possible infection by Anaplasma or Erlichia in SNAP 4DX Plus reactive samples. The genomic DNA was used as the templates to amplify 16S rRNA gene segment by using Ehrlichia/Anaplasma common forward primer (5′CTCAGAACGAACGCTGG 3′) and a modified Ehrlichia/Anaplasma common reverse primer (5′ ACCATTTCTARTGCTATYCCRTACTA 3′) described by Sirigireddy and Ganta [16]. The PCRs were performed with 200 ng of genomic DNA using the Melt Doctor mix (Applied Biosystems) and 300 nM of each primer. The thermal cycles performed in 7500 real-time PCR systems (Applied Biosystems) included the initial denaturation for 10 min at 95°C, 50 cycles of 95°C for 15 sec and 60°C for 60 sec, followed by a HRM curve from 65 to 95°C, with an increase of 0.1°C at each step. The amplification of Anaplasma or Ehrlichia genera was confirmed by melting curve analysis with HRM Software 2.0.1 (Applied Biosystems).

The program SPSS version 18.0 (SPSS, Chicago, Illinois, USA) was used for statistical analysis, with data presented as frequency and percentage. The chi-square assay was used to evaluate the association between diagnostic assay. The agreement was found using Kappa’s coefficient [17].