Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Original Article

Establishment of a Tm-shift Method for Detection of Cat-Derived Hookworms

The Korean Journal of Parasitology 2019;57(1):9-15.
Published online: February 26, 2019

Guangdong Provincial Zoonosis Prevention and Control Key Laboratory, College of Veterinary Medicine, South China Agricultural University, Guangzhou 510542, P. R. China

*Corresponding author (gqli@scau.edu.cn)
• Received: November 19, 2018   • Revised: January 25, 2019   • Accepted: February 6, 2019

Copyright © 2019 by The Korean Society for Parasitology and Tropical Medicine

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 9,048 Views
  • 101 Download
  • 4 Web of Science
  • 3 Crossref
  • 4 Scopus
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Genetic characterization of zoonotic hookworms infecting wild felids in northern India
    Thangam Venkatesan, Rasmita Panda, Anil Kumar Nehra, Hira Ram, M. Karikalan, Devendra Prasad Pateer, Rajat Garg, A. M. Pawde
    BMC Veterinary Research.2025;[Epub]     CrossRef
  • A novel A > G polymorphism in the intron 2 of TBX3 gene is significantly associated with body size in donkeys
    Gang Wang, Mei Li, Jun Zhou, Xiaoya An, Fuxia Bai, Yuan Gao, Jie Yu, Haijing Li, Chuzhao Lei, Ruihua Dang
    Gene.2021; 785: 145602.     CrossRef
  • Cutaneous Larva Migrans
    Alfonso J. Rodriguez-Morales, Natalia González-Leal, Maria Camila Montes-Montoya, Lorena Fernández-Espíndola, D. Katterine Bonilla-Aldana, José María Azeñas- Burgoa, Juan Carlos Diez de Medina, Verónica Rotela-Fisch, Melany Bermudez-Calderon, Kovy Arteaga
    Current Tropical Medicine Reports.2021; 8(3): 190.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Establishment of a Tm-shift Method for Detection of Cat-Derived Hookworms
Korean J Parasitol. 2019;57(1):9-15.   Published online February 26, 2019
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Establishment of a Tm-shift Method for Detection of Cat-Derived Hookworms
Korean J Parasitol. 2019;57(1):9-15.   Published online February 26, 2019
Close

Figure

  • 0
  • 1
  • 2
Establishment of a Tm-shift Method for Detection of Cat-Derived Hookworms
Image Image Image
Fig. 1 PCR amplification of the ITS1 sequence of 2 hookworms. M, DL-500 DNA marker; 1, Positive control; 2, A. ceylanicum; 3, A. tubaeforme; 4, Negative control.
Fig. 2 Standard curves of Tm-shift for 2 hookworm standard plasmids based on ITS101 (A) and ITS296 (B). AceP, A. ceylanicum standard plasmid; AtuP, A. tubaeforme standard plasmid; Neg, negative control.
Fig. 3 Melting curve of Tm-shift based on ITS101 (A) and ITS296 (B) and detection results for 12 hookworm-positive samples.
Establishment of a Tm-shift Method for Detection of Cat-Derived Hookworms

Primers for Tm-shift method based on 2 SNPs

Primer Nucleotide sequence (5′-3′) Product length (bp)
ITS101AF (Atu) gattaccg GGCGGCAGTGATTGCTGTA
ITS101GF (Ace) gcgggcagggcggg GGCGGCAGTGATTGCTGTG 106
ITS101R GCCTAATGCTCAACCACCAACA
ITS296TF (Ace) gattaccg TTTGCAGAATCGTGACTTT
ITS296AF (Atu) gcgggcagggcggg TTTGCAGAATCGTGACTTA 127
ITS296R TTCACCACTCTAAGCGTCT

GC tails are underlined.

Stability of Tm-shift method

Repeat ITS101 (Tm) (°C) ITS296 (Tm) (°C)


AtuP AceP AtuP AceP
First (n=7) 86.49±0.09 88.25±0.10 86.63±0.07 85.01±0.09

Second (n=7) 86.47±0.07 88.21±0.06 86.60±0.10 85.04±0.06

Third (n=7) 86.44±0.09 88.26±0.11 86.59±0.11 85.00±0.10

Average (n=21) 86.47 88.24 85.00 86.60

CV (%) 0.06 0.07 0.08 0.06

Sensitivity of Tm-shift method

Dilution ITS101 (Tm) (°C) ITS296 (Tm) (°C)


AtuP AceP AtuP AceP
1:101 86.50 88.25 86.60 85.00

1:102 86.50 88.25 86.65 85.00

1:103 86.50 88.35 86.60 84.90

1:104 86.50 88.35 86.60 85.00

1:105 86.40 88.15 86.50 85.00

1:106 86.40 88.25 86.60 85.10

1:107 86.40 88.25 86.60 85.10

1:108 - - - -

-, Not detected.

The accuracy of Tm-shift method

Sample Species ITS101 (Tm) (°C) ITS296 (Tm) (°C) GenBank
M6 A. ceylanicum 88.25 85.00 KF279134
M55 A. ceylanicum 88.25 85.00 KF279135
M58 A. ceylanicum 88.25 85.00 KF279136
M60 A. ceylanicum 88.35 85.00 KF279137
M76 A. ceylanicum 88.25 85.10 KF279138
C1 A. tubaeforme 86.50 86.60 MG904956
C2 A. tubaeforme 86.50 86.60 MG904957
C3 A. tubaeforme 86.40 86.60 MG904958
C4 A. tubaeforme 86.50 86.60 MG904959
C5 A. tubaeforme 86.40 86.50 MG904960

Sample M6, M55, M58, M60, M76 were isolated and identified by Liu et al. [4]. The sequences of sample C1, C2, C3, C4, and C5 have been uploaded to GenBank.

Table 1 Primers for Tm-shift method based on 2 SNPs

GC tails are underlined.

Table 2 Stability of Tm-shift method
Table 3 Sensitivity of Tm-shift method

-, Not detected.

Table 4 The accuracy of Tm-shift method

Sample M6, M55, M58, M60, M76 were isolated and identified by Liu et al. [4]. The sequences of sample C1, C2, C3, C4, and C5 have been uploaded to GenBank.