Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Brief Communication

Hydrogenosomal activity of Trichomonas vaginalis cultivated under different iron conditions

The Korean Journal of Parasitology 2006;44(4):373-378.
Published online: December 20, 2006

1Department of Biochemistry and Molecular Biology, Hanyang University College of Medicine, Seoul 133-791, Korea.

2Department of Parasitology, The Brain Korea 21 Project, Hanyang University College of Medicine, Seoul 133-791, Korea.

3Department of Parasitology and Institute of Tropical Medicine, The Brain Korea 21 Project, Yonsei University College of Medicine, Seoul 120-752, Korea.

Corresponding author (jsryu@hanyang.ac.kr)
• Received: October 31, 2006   • Accepted: November 24, 2006

Copyright © 2006 by The Korean Society for Parasitology

  • 9,848 Views
  • 113 Download
  • 12 Crossref
  • 12 Scopus
prev

Citations

Citations to this article as recorded by  Crossref logo
  • Alloferon regulates the growth and movement of Trichomonas vaginalis by altering hydrogenosomes
    Hyejung Jo, Minsoo Kang, Yejin Kim, Jae Seung Kang
    BMC Infectious Diseases.2026;[Epub]     CrossRef
  • Molecular Targets Implicated in the Antiparasitic and Anti-Inflammatory Activity of the Phytochemical Curcumin in Trichomoniasis
    Natalia Mallo, Jesús Lamas, Rosa Ana Sueiro, José Manuel Leiro
    Molecules.2020; 25(22): 5321.     CrossRef
  • Influence of 120 kDa Pyruvate:Ferredoxin Oxidoreductase on Pathogenicity of Trichomonas vaginalis
    Hyun-Ouk Song
    The Korean Journal of Parasitology.2016; 54(1): 71.     CrossRef
  • Nitric oxide maintains cell survival of Trichomonas vaginalis upon iron depletion
    Wei-Hung Cheng, Kuo-Yang Huang, Po-Jung Huang, Jo-Hsuan Hsu, Yi-Kai Fang, Cheng-Hsun Chiu, Petrus Tang
    Parasites & Vectors.2015;[Epub]     CrossRef
  • RNA-Binding Proteins in Trichomonas vaginalis: Atypical Multifunctional Proteins
    Elisa Figueroa-Angulo, Jaeson Calla-Choque, Maria Mancilla-Olea, Rossana Arroyo
    Biomolecules.2015; 5(4): 3354.     CrossRef
  • Optimal Reference Genes for Gene Expression Normalization in Trichomonas vaginalis
    Odelta dos Santos, Graziela de Vargas Rigo, Amanda Piccoli Frasson, Alexandre José Macedo, Tiana Tasca, Robert W Dettman
    PLOS ONE.2015; 10(9): e0138331.     CrossRef
  • Prostatic Disease Associated withTrichomonas vaginalis
    Jae-Sook Ryu
    The Korean Journal of Urogenital Tract Infection and Inflammation.2014; 9(2): 61.     CrossRef
  • Hydrogenosome Metabolism Is the Key Target for Antiparasitic Activity of Resveratrol against Trichomonas vaginalis
    Natalia Mallo, Jesús Lamas, José M. Leiro
    Antimicrobial Agents and Chemotherapy.2013; 57(6): 2476.     CrossRef
  • Responsiveness of Trichomonas vaginalis to iron concentrations: Evidence for a post-transcriptional iron regulation by an IRE/IRP-like system
    J.C. Torres-Romero, R. Arroyo
    Infection, Genetics and Evolution.2009; 9(6): 1065.     CrossRef
  • Proinflammatory Cytokine and Nitric Oxide Production by Human Macrophages Stimulated with Trichomonas vaginalis
    Ik-Hwan Han, Sung Young Goo, Soon-Jung Park, Se-Jin Hwang, Yong-Seok Kim, Michael Sungwoo Yang, Myoung-Hee Ahn, Jae-Sook Ryu
    The Korean Journal of Parasitology.2009; 47(3): 205.     CrossRef
  • Trichomonas vaginalis: The adhesins AP51 and AP65 bind heme and hemoglobin
    Shahed Ardalan, B. Craig Lee, Gary E. Garber
    Experimental Parasitology.2009; 121(4): 300.     CrossRef
  • Trichomonas vaginalis‐induced neutrophil apoptosis causes anti‐inflammatory cytokine production by human monocyte‐derived macrophages
    M. H. AHN, H. O. SONG, J. S. RYU
    Parasite Immunology.2008; 30(8): 410.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Hydrogenosomal activity of Trichomonas vaginalis cultivated under different iron conditions
Korean J Parasitol. 2006;44(4):373-378.   Published online December 20, 2006
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Hydrogenosomal activity of Trichomonas vaginalis cultivated under different iron conditions
Korean J Parasitol. 2006;44(4):373-378.   Published online December 20, 2006
Close

Figure

  • 0
  • 1
Hydrogenosomal activity of Trichomonas vaginalis cultivated under different iron conditions
Image Image
Fig. 1 RT-PCR of hydrogenosomal enzymes of T. vaginalis cultivated in iron-depleted, normal and iron-supplemented TYM media. A. PCR results of cDNA from T. vaginalis cultivated from iron-depleted TYM containing 100 µM 2,2'-dipyridyl (D), from normal TYM (N), and from iron-supplemented TYM media containing 360 µM ferrous sulfate (F). B. Density of PCR band from amplified hydrogenosomal enzyme of T. vaginalis was measured by Quantity One (version 4.6.2, BioRad, USA) and compensated by the density of PCR band from amplified β-tubulin of the same T. vaginalis. The results were marked as relative density. PFOR = pyruvate ferredoxin oxidoreductase, HYD = hydrogenase, FD = ferredoxin, ME = malic enzyme.
Fig. 2 Mean fluorescent intensities (MFI) of hydrogenosomal membrane potentials of Trichomonas vaginalis cultivated in normal (untreated, □), iron-depleted (Dipyridyl, ▒) and iron-supplmented (Fe, ▪) TYM media from one to four day of infection, measured with flow cytometry after DiOC6 staining. The data are expressed as the means ± SE of 3 separate experiments. *P value < 0.05.
Hydrogenosomal activity of Trichomonas vaginalis cultivated under different iron conditions
Hydrogenosomal enzyme Primer sequence
Ferredoxin (genebank ID= 39939566) CDS-nta) 1 5´ ATGCTCTCTCAGTGCTCTCCTC 3´ (forward)
Ferredoxin (genebank ID= 39939566) CDS-nta) 312 5´ TTAGACCTCGAATGTAGCACCG 3´ (reverse)
Hydrogenase (genebank ID= 1171116) CDS-nta) 778 5´ GGAAAGCAAGAGACAGGTGC 3´ (forward)
Hydrogenase (genebank ID= 1171116) CDS-nta) 1101 5´ TGCATTCTTTATGCCGTGAG 3´ (reverse)
Malic enzyme (genebank ID= 33243007) CDS-nta) 144 5´ CCTCGAGATCCAGAAGAACG 3´ (forward)
Malic enzyme (genebank ID= 33243007) CDS-nta) 456 5´ TTGGAGACGCTTCTCGATTT 3´ (reverse)
Pyruvate:ferredoxin oxidoreductase (genebank ID= 622957) CDS-nta) 3015 5´ TGCTGCTGGTTACACAAAGG 3´ (forward)
Pyruvate:ferredoxin oxidoreductase (genebank ID= 622957) CDS-nta) 3337 5´ GGTCGAGGTTGTAGTCTGGC 3´ (reverse)
Beta-tubulin (genebank ID= 797282) CDS-nta) 480 5´ CCCAGATCGTATCCTCTCCA 3´ (forward)
Beta-tubulin (genebank ID= 797282) CDS-nta) 791 5´ AGACGTGGGAATGGAACAAG 3´ (reverse)
Table 1. Primers for RT-PCR of hydrogenosomal enzymes from Trichomonas vaginalis

CDS-nt = nucleotide number in coding sequence of the DNA