Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Original Article

Seroprevalence and B1 gene Phylogeny of Toxoplasma gondii of Dogs and Cats in Republic of Korea

The Korean Journal of Parasitology 2020;58(3):257-265.
Published online: June 26, 2020

1Parasitic and Honeybee Disease Laboratory, Bacterial and Parasitic Disease Division, Department of Animal & Plant Health Research, Animal and Plant Quarantine Agency, Gimcheon 39660, Korea

2Animal Pathodiagnostic Laboratory, Animal Disease Diagnostic Division, Department of Disease Control & Quarantine, Animal and Plant Quarantine Agency, Gimcheon 39660, Korea

3Postbio Inc., Guri 11906, Korea

4Department of Medical Environmental Biology, Chung-Ang University College of Medicine, Seoul 06974, Korea

*Corresponding author: (choys@korea.kr)
• Received: March 20, 2020   • Revised: June 11, 2020   • Accepted: June 11, 2020

Copyright © 2020 by The Korean Society for Parasitology and Tropical Medicine

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (https://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 7,830 Views
  • 162 Download
  • 7 Web of Science
  • 8 Crossref
  • 7 Scopus
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Molecular detection of Toxoplasma gondii in ticks and their respective host dogs
    Min-Goo Seo, Dongmi Kwak
    Parasites, Hosts and Diseases.2025; 63(1): 66.     CrossRef
  • Prevalence of parasitic infections in stray cats from Gimpo-si, Gyeonggi-do, Korea
    Sooji Hong, Hyejoo Shin, Seungwan Ryoo, Chung-Won Lee, Jae-Young Park, Jong-Yil Chai, Bong-Kwang Jung
    Parasites, Hosts and Diseases.2025; 63(2): 182.     CrossRef
  • Toxoplasma gondii in owned and stray dogs from a Northwestern region of São Paulo State, Brazil: Seroprevalence and geospatial distribution from a One Health perspective
    Fernando Henrique Antunes Murata, Jessica Priscilla Barboza, Fernanda Follis Tasso, Tainara Souza Pinho, Tiago Henrique, Janine Fusco Alves, Carlos Alexandre Guimarães de Souza, Daniel Abrahão, Ubirajara Leoncy de Lavor, Luiz Carlos de Mattos, Chunlei Su,
    One Health.2025; 21: 101222.     CrossRef
  • A 20-year serological survey of Toxoplasma gondii and Neospora caninum infection in dogs with neuromuscular disorders from urban areas in Argentina
    María Laura Gos, María Cecilia Venturini, Lorena De Felice, Andrea Dellarupe, Magdalena Rambeaud, Lais Pardini, Lucía María Campero, Mariana Bernstein, Diana Bacigalupe, Walter Basso, Gastón Moré, Juan Manuel Unzaga
    Veterinary Parasitology.2024; 330: 110235.     CrossRef
  • Seroprevalence and risk factors for Toxoplasma gondii infection in shelter cats in Erzurum province of Turkey
    Başak HANEDAN, Cahit BABÜR, Muhammed Sertaç EROĞLU, Selin Sinem SÜMBÜL, Ömer ALKAN
    Etlik Veteriner Mikrobiyoloji Dergisi.2023; 34(2): 151.     CrossRef
  • Prevalence of Toxoplasma gondii Measured by Western Blot, ELISA and DNA Analysis, by PCR, in Cats of Western Mexico
    María de la Luz Galván-Ramírez, Claudia Charles-Niño, César Pedroza-Roldán, Carolina Salazar-Reveles, Karen Lissete Ocampo-Figueroa, Laura Roció Rodríguez-Pérez, Varinia Margarita Paez-Magallán
    Pathogens.2022; 11(1): 109.     CrossRef
  • Seroprevalence of Toxoplasma gondii in outdoor dogs and cats in Bangkok, Thailand
    Ana Huertas-López, Woraporn Sukhumavasi, Gema Álvarez-García, Silvia Martínez-Subiela, David Cano-Terriza, Sonia Almería, Jitender P. Dubey, Ignacio García-Bocanegra, José Joaquín Cerón, Carlos Martínez-Carrasco
    Parasitology.2021; 148(7): 843.     CrossRef
  • Genetic Analysis of Zoonotic Gastrointestinal Protozoa and Microsporidia in Shelter Cats in South Korea
    Dongmi Kwak, Min-Goo Seo
    Pathogens.2020; 9(11): 894.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Seroprevalence and B1 gene Phylogeny of Toxoplasma gondii of Dogs and Cats in Republic of Korea
Korean J Parasitol. 2020;58(3):257-265.   Published online June 26, 2020
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Seroprevalence and B1 gene Phylogeny of Toxoplasma gondii of Dogs and Cats in Republic of Korea
Korean J Parasitol. 2020;58(3):257-265.   Published online June 26, 2020
Close

Figure

  • 0
  • 1
  • 2
Seroprevalence and B1 gene Phylogeny of Toxoplasma gondii of Dogs and Cats in Republic of Korea
Image Image Image
Fig. 1 PCR on Toxoplasma gondii B1 gene. (A) Sensitivity of B1 gene PCR. Lane 1, DNA size marker; Lanes 2–9, dilution of T. gondii tachyzoites from 104 to 10−3. (B) Specificity of B1 gene PCR. P, positive (T. gondii); N, negative; M, DNA size marker. Lane 1, Neospora caninum; 2, Ehrlichia chaffeensis; 3, Ehrlichia canis; 4, Anaplasma phagocytophilum; 5, Brucella abortus; 6, Coxiella burnetii.
Fig. 2 Real-time PCR of Toxoplasma gondii B1 gene. (A) Sensitivity. (B) Specificity.
Fig. 3 Phylogenetic tree of B1 gene of 5 Toxoplasma gondii samples from stray cats in Korea. Phylograms were generated by neighbor-joining analysis with 1,000 bootstrapped replicates. GenBank accession number of T. gondii is labeled on each line. Sequences of this study are closed circles. Scale bar indicates nucleotide substitution per site.
Seroprevalence and B1 gene Phylogeny of Toxoplasma gondii of Dogs and Cats in Republic of Korea

Primers and annealing conditions of PCR, nested PCR and real-time PCR for Toxoplasma gondii B1 gene

PCR Primer Sequence (5′→3′) Annealing (°C/sec) Amplicon size (bp)
PCR T1 GGAACTGCATCCGTTCATGAG 50/30 501
T2 CAGACGAATCACGGAACTG

Phylogeny Primary PCR Tg1: TGTTCTGTCCTATCGCAACG 48/40 516
Tg2: ACGGATGCAGTTCCTTTCTG
Nested reaction Tg3: TCTTCCCAGACGTGGATTTC 56/60
Tg4: CTCGACAATACGCTGCTTGA

rt-PCR TOXO-P FAM-TCTGTGCAACTTTGGTGTATTCGCAG-TAMRA 50/30
TOXO-F TCCCCTCTGCTGGCGAAAAGT
TOXO-R AGCGTTCGTGGTCAACTATCGATTG

Antibody prevalence of toxoplasmosis in dogs and cats in Korea during 2017–2019

Region Positive/Test

Dog Cat


Domestic Stray Subtotal Domestic Stray Subtotal
Seoul-Gyeonggi-Incheon 0/2,112 15/170 15/2,282 20/876 10/58 30/934

Gangwon 0/91 2/136 2/227 1/5 - 1/5

Daejeon-Chungnam 0/55 6/83 6/138 0/2 23/133 23/135

Chungbuk - 0/19 0/19 0/1 - 0/1

Jeonbuk 0/16 4/44 4/60 0/1 - 0/1

Daegu-Gyeoungbuk 0/37 1/76 1/113 0/10 4/166 4/176

Gwangju-Jeonnam 0/17 8/119 8/136 - 0/10 0/10

Busan-Ulsan-Gyeongnam 0/51 6/163 6/214 0/12 - 0/12

Jeju 1/33 11/136 12/169 0/2 20/36 20/38

Unknown - 0/1 0/1 - - -

Total 1/2,412 53/947 54/3,359 21/909 57/403 78/1,312

P-value* < 0.0001 < 0.0001

*Student’s t-test. p-value compared between domestic and stray groups of dogs and cats.

Antigen prevalence of Toxoplasma gondii in dogs and cats in Korea

Region Positive/Test

Dog Cat


Domestic Stray Subtotal Domestic Stray Subtotal
Seoul-Gyeonggi-Incheon 1/1,250 0/81 1/1,331 3/2,934 2/261 5/3,195

Gangwon 4/331 0/105 4/436 0/9 0/23 0/32

Daejeon-Chungnam 0/86 0/74 0/160 0/17 2/298 2/315

Chungbuk 0/84 0/24 0/108 0/12 - 0/12

Jeonbuk 0/8 0/45 0/53 0/11 0/9 0/20

Daegu-Gyeoungbuk 0/25 1/74 1/99 0/32 0/266 0/298

Gwangju-Jeonnam 0/8 0/81 0/89 0/4 0/48 0/77

Busan-Ulsan-Gyeongnam 1/117 0/108 1/225 0/19 0/51 0/70

Jeju 1/65 0/94 1/159 0/2 0/118 0/120

Unknown - - 0/1 - 3/318 3/318

Total 7/1,974 1/686 8/2,660 3/3,040 7/1,392 10/4,432

P-value* 0.291 0.041

*Student’s t-test. p-value compared between domestic and stray groups of dogs and cats.

Table 1 Primers and annealing conditions of PCR, nested PCR and real-time PCR for Toxoplasma gondii B1 gene
Table 2 Antibody prevalence of toxoplasmosis in dogs and cats in Korea during 2017–2019

Student’s t-test. p-value compared between domestic and stray groups of dogs and cats.

Table 3 Antigen prevalence of Toxoplasma gondii in dogs and cats in Korea

Student’s t-test. p-value compared between domestic and stray groups of dogs and cats.