Female BALB/c mice were obtained from the Korea Research Institute of Bioscience and Biotechnology (Daejeon, Korea). All mice used were of 10-12 weeks of age, and were documented as specific-pathogen-free animals. RH and 76K strains of T. gondii were utilized. The RH strain was employed in the preparation of Toxoplasma lysate antigen (TLA), and this strain was maintained in vitro on human foreskin fibroblasts in an atmosphere of 5% CO₂, at 37℃. The 76K strain was used to infect BALB/c mice for a study on immunological effects of reactivated toxoplasmosis.

Infected fibroblasts were scraped, forcibly passed through a 27-gauge needle, and centrifuged for 10 min at 900 g using Percoll (Sigma Chemical Co., St. Louis, Missouri, USA) to pellet the parasites. Then, the parasites were sonicated on ice and centrifuged for 40 min at 100,000 g. The supernatants were pooled and sterile filtered (Gelman Sciences, Ann Arbor, Michigan, USA) and the protein contents were determined via the Bradford method, using bovine serum albumin as the standard. Parasite antigens (TLA) were stored in aliquots at -20℃ until use.

The 76K strain cysts of T. gondii were prepared by homogenization of the brain tissue in saline, and 25 cysts were intragastrically administered to mice (Toxo-infected group). In accordance with the procedure described by Nicoll et al. (1997), the mice were administered 10 mg/L of dexamethasone (Sigma) in drinking water 4-8 weeks after infection, in order to induce the reactivation of cerebral toxoplasmosis (Toxo/Dexa-treated group). In parallel with the Toxo/Dexa-treated group, uninfected mice were also treated with dexamethasone (Dexa-treated group). All groups receiving dexamethasone were administered 1 mg/L oxytetracycline (Sigma) in drinking water for the duration of the study, in order to reduce contraction of other opportunistic infections. Control mice (uninfected and untreated) were treated in similar manners with tap water. Mice were serially killed after infection, and survival days, antibody titers, Th1/Th2 cytokine production, and parasite burdens were evaluated. To decrease the bias of each mouse, mice were selected evenly at indicated time points.

Southern blots for quantification of tissue parasite burdens were conducted in accordance with the procedure described by Meyer et al. (2000). DNA was prepared from mouse brains by homogenization of 100 mg tissue in 2 ml 0.1 M NaCl, 0.2 M sucrose, 0.01 M EDTA and 0.3 M Tris (pH 8.0). The solution was then incubated for 2 hr at 65℃ after addition of 10% SDS and proteinase K (100 µg/ml). Potassium acetate (8 M) was then added, followed by 1 hr of precipitation of the solution at 4℃ and 10 min of centrifugation at 5,000 g. The aqueous phase was extracted with phenol/chloroform and precipitated with ethanol. The oligonucleotide primers used to initiate DNA amplification were complementary to the segments of the B1 gene (5'GGAACTGCATCCGTTCATGAG and 5'-TCTTTAAAGCGTTCGTGGTC) or P30 gene (5'ATGTCGGTTTCGCTGCACTTC and 5'TCACGCGACACAAGCTGCGATAGAGCC) of T. gondii DNA that had been PCR amplified in a solution containing 10 mM Tris-HCl (pH 8.3), 1.5 mM MgCl₂, 50 mM KCl, 200 µM of each deoxynucleotide, and 0.4 µM of primers. A positive control (DNA extracted directly from tachyzoites of RH strain) and a negative control (distilled water) were tested for each reaction. We applied the same volume of DNA already adjusted to the same optical density, such that the applied volume of each lane was identical in all experiments. The reaction was conducted for 35 cycles, each consisting of 60 sec at 94℃, 90 sec at 55℃, and 60 sec at 72℃. After migration on 2% agarose gel, the PCR products were passively transferred onto nylon membranes. The membranes were fixed for 15 min at 120℃. The blots were pre-hybridized for 3 hr at 42℃. For hybridization, a non-isotopic 5'-GGCGACCAATCTGCGAATACACC probe (B1 gene) or 5'CTCCCACTCTTGCGTCACC (P30 gene) was used. For development, the probe was labeled at the end with digoxigenin (Boehringer Mannheim, Berlin, Germany). After rinsing, the membrane was hybridized with an anti-digoxigenin antibody, which was labeled with alkaline phosphatase. After further rinsing, the membrane was developed using the chemiluminescent substrate, CSPD [isodium 3-(4-methoxyspirofl,2-dioxetane-3,2'-(5'-chloro)tricyclo [3.3.1.1^3,7]decan)4-yl) phenyl phosphate] (DIG Luminescent Detection Kit, Roche Molecular Biochemicals, Berlin, Germany), and detected by exposure on X-ray film. DNA was quantified using an imaging densitometer.

Each well of a 96-well plate was coated with TLA (10 µg/ml), then incubated overnight at 4℃. After blocking, the serum samples were diluted to 1:100 in 0.1% BSA/PBS containing 0.05% Tween 20 and added at 100 µl per well. After 2 hr, HRP-conjugated goat anti-mouse IgG, IgG1, IgG2a, IgA or IgM (Southern Biotechnology Associates Inc., Birmingham, Alabama, USA) was applied. After washing, freshly prepared o-phenylenediamine dihydrochloride was added, and the reaction was halted via the addition of 4N H₂SO₄ Optical density was read at 492 nm, using a Titertek Multiscan ELISA reader (Laboratory Systems, Helsinki, Finland).

Spleens from mice were homogenized, and erythrocytes were lysed with Tris-NH₄Cl (pH 7.2). After washing with RPMI 1640 (Sigma), splenocytes were resuspended in complete RPMI 1640 medium containing 10% FBS, 1 mM sodium pyruvate (Sigma), 100 U/ml penicillin, and 0.1 mg/ml streptomycin. The splenocytes were cultured with TLA (20 µl/ml) in 96-well flat-bottom tissue culture plates (200 µl of 4 × 10⁶ cells/ml) for 48 hr at 37℃ in 5% CO₂. Cell-free supernatants were harvested and stored at -20℃ until assayed for cytokines.

Mouse IFN-γ, IL-2, IL-4, IL-5, and IL-10 levels were determined using a cytokine detection ELISA kit (Genzyme, Cambridge, Massachusetts, USA) in accordance with the manufacturer's protocols. Each well of a 96-well microtiter plate was coated with 100 µl of hamster anti-mouse IFN-γ, IL-2, IL-4, IL-5, or IL-10, diluted in 0.05 M carbonate buffer (pH 9.5), and incubated overnight at 4℃. The plates were washed 3 times, and blocked with 1% BSA/PBS. Culture supernatants or recombinant mouse IFN-γ, IL-2, IL-4, IL-5 or IL-10 standards were then applied to the plates, and incubated for 1 hr at 37℃. After washing, biotinylated goat anti-mouse IFN-γ, IL-2, IL-4, IL-5 or IL-10 was added, and the plates were incubated for an additional 1 hr at 37℃. One hundred µl of HRP-conjugated streptavidin was then added to each microtiter well. Binding was visualized using tetramethylbenzidine containing H₂O₂. The reaction was halted with 2N H₂SO₄, and the absorbance was read at 450 nm on a Titertek Multiscan plate reader. IFN-γ, IL-2, IL-4, IL-5 and IL-10 levels were quantitated via reference to standard curves generated using rIFN-γ, IL-2, IL-4, IL-5, or IL-10.

Splenocytes containing 1 × 10⁶ cells were incubated with either 50 µl of FITC-conjugated anti-mouse CD4+ and CD8α+ monoclonal antibodies (1:100 dilution in 0.1% BSA/PBS; PharMingen, San Diego, California, USA) or with an isotype-specific control (PharMingen) for 60 min at 4℃. The cells were washed 3 times in 0.1% BSA/PBS via centrifugation, fixed with 1% paraformaldehyde, and analyzed by flow cytometry (FACScan, Becton Dickinson, Franklin Lakes, New Jersey, USA). Data were analyzed using the Cell-Quest program (Becton Dickinson).

Results are expressed as the mean ± standard deviation (SD) for each group. Statistical evaluations of differences in survival days, antibody titers, cytokine levels, and T cell subset percentages were conducted using 2-tailed Mann-Whitney U tests and Student's t-tests. Differences were considered significant at a P-value of < 0.05.

As shown in Fig. 1, none of the Toxoplasma-infected BALB/c (Toxo-infected) mice died after infection throughout the experimental period. However, survival times (in days) of the dexamethasone-treated uninfected and Toxoplasma-infected BALB/c (Dexa-treated and Toxo/Dexa-treated group, respectively) mice were shortened. The mean survival days of the Toxo/Dexa-treated group were significantly lower than those of the Toxo-infected group (44.6 ± 8.9 days vs. 56.0 ± 0.0 days, P = 0.0029), and we also detected a significant difference between the survival days of the Toxo/Dexa-treated and Dexa-treated groups (44.6 ± 8.9 days vs. 51.5 ± 9.5 days, P = 0.027). However, the survival time of the Dexa-treated group was similar to that of the Toxo-infected group (51.5 ± 9.5 days vs. 56.0 ± 0.0 days, P = 0.16).

Toxoplasma-specific P30 and B1 genes were not detected in the Dexa-treated mice; however, Toxo-infected mice evidenced expression of both the Toxoplasma-specific P30 and B1 genes (Fig. 2). In the Toxo-infected mice, parasite burdens in the brain reached a maximum at approximately 4 weeks after infection, and thereafter the number of parasites in the brain stabilized. After dexamethasone treatment in the Toxo-infected mice, the expression of the Toxoplasma P30 and B1 genes in the brains of the Toxo/Dexa-treated mice increased as compared to the Toxo-infected mice, and peaked 4 weeks after dexamethasone treatment, i.e., 8 weeks postinfection (PI).

Serum samples from the Toxo-infected, Dexa-treated, and Toxo/Dexa-treated mice were assayed for IgG, IgG1, IgG2a, IgA, and IgM titers against TLA using ELISA (Figs. 3A, 3B, 3C, 3D, and 3E, respectively). We detected no significant increases of any type of antibodies in the Dexa-treated mice as compared with the uninfected mice (day 0). The specific IgG, IgG2a, and IgM titers were found to have increased immediately after T. gondii infection, in comparison to that of the uninfected mice (Figs. 3A, 3C and 3E, respectively), whereas the IgG2a and IgA titers increased significantly 2 weeks after infection (Figs. 3B and 3D, respectively).

From 4 weeks after infection, the Toxoplasma-infected mice were treated with dexamethasone in their drinking water (Toxo/Dexa-treated group), after which the antibody titers were serially checked. The specific IgG, IgG2a, IgA, and IgM titers of the Toxo/Dexa-treated mice were depressed significantly after dexamethasone treatment. In particular, the titers of IgG2a and IgM were decreased markedly (Figs. 3C and 3E, respectively). We detected no specific difference in IgG1 titers between the Toxo-infected and Toxo/Dexa-treated mice (Fig. 3B).

The proportions of each T cell subset in the Toxo-infected, Dexa-treated, and Toxo/Dexa-treated mice are shown in Table 1. In the uninfected mice, the relative percentages of CD4+ and CD8α+ T cells in the spleen were approximately 38.8 ± 4.2% and 18.8 ± 1.8%, respectively. The percentages of CD4+ T cells of splenocytes from the Toxo-infected mice were not significantly altered in comparison to those observed in the uninfected mice, although we did observed a temporary reduction. In the Dexa- and Toxo/Dexa-treated mice, the percentages of CD4+ or CD8α+ T cells were reduced significantly 2 weeks after dexamethasone treatment (38.8 ± 4.2% vs. 21.1 ± 2.9% in CD4+ T cells of Toxo/Dexa-treated mice, P = 0.003; 18.8 ± 1.8% vs. 12.3 ± 1.9% in CD8+ T cells, P = 0.024), and then slowly recovered to original levels thereafter.

We assessed the production of Th1 and Th2 cytokines from the culture supernatants from splenocytes. The spleen cells from the Toxo-infected, Dexa-treated, and Toxo/Dexa-treated mice were stimulated for 48 hr with TLA, after which the levels of IFN-γ, IL-2, IL-4, IL-5, and IL-10 were assessed using ELISA (Figs. 4A, 4B, 4C, 4D and 4E, respectively). IFN-γ, IL-2, IL-4, IL-5, and IL-10 production levels in the Dexa-treated mice were similar to those seen in the uninfected mice (P > 0.05). In the Toxo-infected mice, IFN-γ, IL-5 and IL-10 productions increased immediately after T. gondii infection (P < 0.05), whereas IL-2 production was increased significantly after 2 weeks PI. At 5 weeks PI, the IFN-γ production levels of the Toxo-infected mice increased by more than 20-fold those of the uninfected mice. However, IL-2 and IL-5 productions increased only by approximately 2 fold. IL-4 production in the Toxo-infected mice remained at basal levels until 4 weeks PI, after which IL-4 production increased slightly (Fig. 4C). After immunosuppression, IFN-γ and IL-10 productions were depressed significantly (Figs. 4A and 4E, respectively), whereas IL-4 production increased markedly 2 weeks after immunosuppression (i.e., 6 weeks PI) (Fig. 4C). IL-2 and IL-5 productions in the Toxo/Dexa-treated mice evidenced no significant differences in comparison to the Toxo-infected mice (Figs. 4B and 4D).