Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Original Article

Infection Status of Hospitalized Diarrheal Patients with Gastrointestinal Protozoa, Bacteria, and Viruses in the Republic of Korea

The Korean Journal of Parasitology 2010;48(2):113-120.
Published online: June 17, 2010

1Department of Malaria and Parasitic Diseases, Korea National Institute of Health, Korea Centers for Disease Control and Prevention, Seoul, Korea.

2Department of AIDS, Korea National Institute of Health, Korea Centers for Disease Control and Prevention, Seoul, Korea.

3Department of Environmental and Tropical Medicine, Konkuk University School of Medicine, Seoul, Korea.

4Department of Parasitology and Inha Research Institute for Medical Sciences, Inha University College of Medicine, Incheon, Korea.

5Department of Enteric Bacterial Infections, Korea National Institute of Health, Korea Centers for Disease Control and Prevention, Seoul, Korea.

6Department of Enteric and Hepatitis Viruses, Korea National Institute of Health, Korea Centers for Disease Control and Prevention, Seoul, Korea.

7Department of Influenza and Respiratory Viruses, Korea National Institute of Health, Korea Centers for Disease Control and Prevention, Seoul, Korea.

Corresponding author (ilcheun7@korea.kr)

These authors equally contributed as the first author.

• Received: January 26, 2010   • Revised: April 15, 2010   • Accepted: April 21, 2010

Copyright © 2010 by The Korean Society for Parasitology

  • 11,045 Views
  • 96 Download
  • 19 Crossref
  • 24 Scopus
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Pediatric Rotavirus A Infection Among 337,019 Participants Within Asia: A Pan‐Asian Systematic Review and Meta‐Analysis
    Ali A. Rabaan, Bello E. Kizito, Abdulsalam Alawfi, Amer Alshengeti, Amal H. Alfaraj, Wadha A. Alfouzan, Haya Altawalah, Dalal Meshal Bashah, Alya Aali Almatrafi, Amal Abdulqadir Mujahed, Bandar Alwan Albaradi, Mohammed Garout, Heba A. Alsaffar, Mona A. Al
    Journal of Tropical Medicine.2026;[Epub]     CrossRef
  • Molecular mechanisms of Shigella effector proteins: a common pathogen among diarrheic pediatric population
    Ahmad Nasser, Mehrdad Mosadegh, Taher Azimi, Aref Shariati
    Molecular and Cellular Pediatrics.2022;[Epub]     CrossRef
  • Prevalence of rotavirus among older children and adults with diarrhea: A systematic review and meta-analysis
    Lola Arakaki, Deanna Tollefson, Brenda Kharono, Paul K. Drain
    Vaccine.2021; 39(33): 4577.     CrossRef
  • Antioxidants, inhibits the growth of foodborne pathogens and reduces nitric oxide activity in LPS-stimulated RAW 264.7 cells of nipa palm vinegar
    Wilaiwan Senghoi, Wiyada Kwanhian Klangbud
    PeerJ.2021; 9: e12151.     CrossRef
  • Molecular Detection and Epidemiological Features of Selected Bacterial, Viral, and Parasitic Enteropathogens in Stool Specimens from Children with Acute Diarrhea in Thi-Qar Governorate, Iraq
    Ali Harb, Sam Abraham, Bertha Rusdi, Tanya Laird, Mark O’Dea, Ihab Habib
    International Journal of Environmental Research and Public Health.2019; 16(9): 1573.     CrossRef
  • Molecular Prevalence and Genotypes of Cryptosporidium parvum and Giardia duodenalis in Patients with Acute Diarrhea in Korea, 2013-2016
    Da-Won Ma, Myoung-Ro Lee, Sung-Hee Hong, Shin-Hyeong Cho, Sang-Eun Lee
    The Korean Journal of Parasitology.2019; 57(5): 531.     CrossRef
  • Monitoring of Noxious Protozoa for Management of Natural Water Resources
    Young Yil Bahk, Pyo Yun Cho, Sung Kyu Ahn, Sangjung Park, Won Hwa Jheong, Yun-Kyu Park, Ho-Joon Shin, Sang-Seob Lee, Okjae Rhee, Tong-Soo Kim
    The Korean Journal of Parasitology.2018; 56(2): 205.     CrossRef
  • Horizontal Gene Transfers from Bacteria toEntamoebaComplex: A Strategy for Dating Events along Species Divergence
    Miguel Romero, R. Cerritos, Cecilia Ximenez
    Journal of Parasitology Research.2016; 2016: 1.     CrossRef
  • A Case of Colitis by <i>Giardia lamblia</i> Infection with Atypical Presentation
    Soo Kyoung Choi, Youn Hee Lee, Jinhee Lee, Seon Ho Park, Mi Hee Kim, Ok-Ran Shin, Young-Seok Cho
    The Korean Journal of Medicine.2015; 89(3): 312.     CrossRef
  • Fatal cryptosporidiosis in a calf
    Kang-Hyun Baek, Hyun-Kyoung Lee, Kyung-Hyun Lee, Ha-Young Kim, Jung-Won Park, Bo-Ram Lee, Ji-Woong Her, Myoung-Heon Lee, You-Chan Bae
    Korean Journal of Veterinary Research.2014; 54(4): 257.     CrossRef
  • The First Outbreak of Giardiasis with Drinking Water in Korea
    Hyeng-Il Cheun, Cheon-Hyeon Kim, Shin-Hyeong Cho, Da-Won Ma, Bo-La Goo, Mun-Su Na, Seung-Ki Youn, Won-Ja Lee
    Osong Public Health and Research Perspectives.2013; 4(2): 89.     CrossRef
  • Chemotherapeutic drugs for common parasitic diseases in Korea
    Sun Huh
    Journal of the Korean Medical Association.2013; 56(6): 513.     CrossRef
  • Prevalence and characters of Entamoeba histolytica infection in Saudi infants and children admitted with diarrhea at 2 main hospitals at south Jeddah: a re-emerging serious infection with unusual presentation
    Moustafa Abdelaal Hegazi, Tabarek Ahmed Patel, Basem Salama El-Deek
    The Brazilian Journal of Infectious Diseases.2013; 17(1): 32.     CrossRef
  • Health Risk Assessment of Cryptosporidium in Tap Water in Korea
    Mok-Young Lee, Sang-Jung Park, Eun-Joo Cho, Su-Jeong Park, Sun-Hee Han, Oh-Sang Kwon
    Korean Journal of Environmental Health Sciences.2013; 39(1): 32.     CrossRef
  • Enteric Protozoa in the Developed World: a Public Health Perspective
    Stephanie M. Fletcher, Damien Stark, John Harkness, John Ellis
    Clinical Microbiology Reviews.2012; 25(3): 420.     CrossRef
  • A Ten-year Survey ofGiardia Cystsin Drinking Water Supplies of Seoul, the Republic of Korea
    Mok-Young Lee, Eun-Joo Cho, Jin-Hyo Lee, Sun-Hee Han, Yong-Sang Park
    The Korean Journal of Parasitology.2011; 49(1): 9.     CrossRef
  • Trend in Viral Infectious Diseases in Children
    Sung Hee Oh
    Infection and Chemotherapy.2011; 43(6): 435.     CrossRef
  • Defining the causes of diarrhea
    Darwin J. Operario, Eric Houpt
    Current Opinion in Infectious Diseases.2011; 24(5): 464.     CrossRef
  • Burden of rotavirus and other enteropathogens among children with diarrhea in Burkina Faso
    Leon W. Nitiema, Johan Nordgren, Djeneba Ouermi, Dayeri Dianou, Alfred S. Traore, Lennart Svensson, Jacques Simpore
    International Journal of Infectious Diseases.2011; 15(9): e646.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Infection Status of Hospitalized Diarrheal Patients with Gastrointestinal Protozoa, Bacteria, and Viruses in the Republic of Korea
Korean J Parasitol. 2010;48(2):113-120.   Published online June 17, 2010
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Infection Status of Hospitalized Diarrheal Patients with Gastrointestinal Protozoa, Bacteria, and Viruses in the Republic of Korea
Korean J Parasitol. 2010;48(2):113-120.   Published online June 17, 2010
Close

Figure

  • 0
  • 1
Infection Status of Hospitalized Diarrheal Patients with Gastrointestinal Protozoa, Bacteria, and Viruses in the Republic of Korea
Image Image
Fig. 1 Sampling areas (16 Regional Institutes of Health and Environment, Korea) and protocol of the present study. Numbers within the circle represent the number of hospitals subjected in each institute.
Fig. 2 Seasonal patterns of mixed infections with protozoa. Noro, norovirus; Rota, rotavirus; Adeno, enteric adenovirus; Astro, astrovirus; Clos, Clostridium perfringens (alpha toxin, enterotoxin, or nontoxin); Staph, Staphylococcus aureus (toxins A, B, C, D, and E); E. coli, pathogenic E. coli (STEC, EAEC, EPEC, ETEC, and EIEC); Bacil, Bacillus cereus (hemolysin BL-enterotoxin, nonhemolytic enterotoxin); Shi, Shigella flexneri.
Infection Status of Hospitalized Diarrheal Patients with Gastrointestinal Protozoa, Bacteria, and Viruses in the Republic of Korea
Pathogen Target gene Sequence (5′-3′) Size of PCR product (bp) GenBank No. or reference Salmonella spp. Invasion-associated locus (inv) ATTAATTATGGAAGCGCTCGCATT 247 U84286 GTAATGAGATCCATCAAATTAGCG Shigella spp. Invasion-associated locus (ial) GTTGCGCTTGATGGGTGGGGTATC 356 L25276 GAAATGTCCATCAAACCCCACTC Escherichia coli STEC Shiga toxin 1 (stx1) CGTACGGGGATGCAGATAAATCGC 210 AB048231 CAGTCATTACATAAGAACGCCCAC Shiga toxin 2 (stx2) GTTCTGCGTTTTGTCACTGTCAC 326 AB048835 GTCGCCAGTTATCTGACATTCTGG Escherichia coli EAEC Heat-stable enterotoxin (east1) ATGCCATCAACACAGTATATCCG 119 AB042002 TCAGGTCGCGAGTGACGGCTTT Escherichia coli EPEC Attaching and effacing (eaeA) ATGCTGGCATTTGGTCAGGTCGG 233 AF319597 TGACTCATGCCAGCCGCTCATGCG Escherichia coli ETEC Heat-labile toxin (lt) GATCACGCGAGAGGAACACAAACC 366 X83966 ATCTGTAACCATCCTCTGCCGGAG Heat-stable toxin (st) CTTTCCCCTCTTTTAGTCAGTC 167 M35586 CACAGGCAGGATTACAACAAAGT Escherichia coli EIEC Invasion-associated locus (ial) GTTGCGCTTGATGGGTGGGGTATC 356 In this study GAAATGTCCATCAAACCCCACTC Vibrio parahaemolyticus Thermostable direct hemolysin (tdh) CTTCCATCTGTCCCTTTTCCTGCC 217 S76724 ATGTTCACAGTCATGTAGGATGTC Yersinia enterocolitica Attachment invasion locus (ail) TTATCAATTGCGTCTGTTAATGTG 449 M29945 GACTTTGGAGTATTCATATGAAGC Norovirus Capsid region (GI) CTGCCCGAATTYGTAAATGAT GAT 314 Kim et al. 2005 CCAACCCARCCATTRTACATYTG Capsid region (GII) GGGAGGGCGATCGCAATCT 313 Kim et al. 2005 CCRCCIGCATRICCRTTRTACAT Distribution of study population
Protozoa
Virus
Bacteria
Number (%) No. of positives Positivity (95% CI) AOR (95% CI) P-value No. of positives Positivity (95% CI) AOR (95% CI) P-value No. of positives Positivity (95% CI) AOR (95% CI) P-value Total 76,652 987 129 13,479 1,759 13,771 1,797 (121-137) (1,732-1,785) (1,769-1,8244) GENDER (n = 60,230)  Male 33,166 382 196 Reference - 5,746 1,733 Reference - 5,908 1,781 Reference - (55) (174-217) (1,692-1,773) (1,740-1,823)  Female 27,064 284 115 0.9 0.2334 4,614 1,705 1.0 0.2206 4,795 1,772 1.0 0.1198 (45) (104-127) (0.8-1.1) (1,660-1,750) (1.0-1.1) (1,726-1,817) (0.9-1.0) AGE (year) (n = 62,867) Mean age: 23 (SE : 27.7) years Median age: 5 (IQR : 1-49) years  ≤5 32,278 442 137 Reference - 8,622 2,671 Reference - 4,610 1,428 Reference - (51.3) (124-150) (2,623-2,719) (1,390-1,466)  6-9 2,979 30 101 0.8 0.0115 433 1,454 0.5 < 0.0001 645 2,165 1.6 < 0.0001 (4.7) (65-137) (0.8-1.1) (1,327-1,580) (0.4-0.5) (2,017-2,313) (1.5-1.8)  10-49 12,216 130 106 0.8 0.2123 930 761 0.2 < 0.0001 2,336 1,912 1.4 < 0.0001 (19.4) (88-125) (0.6-0.9) (714-808) (0.2-0.3) (1,843-1,982) (1.4-1.5)  ≥50 15,394 201 131 1.0 0.6195 1,010 656 0.2 < 0.0001 3,196 2,076 1.6 < 0.0001 (24.5) (113-149) (0.8-1.1) (617-695) (0.2-0.2) (2,012-2,140) (1.5-1.7) Area (n = 76,652) Province 38,022 537 141 Reference - 8,056 1,426 Reference - 7,277 1,708 Reference - (49.6) (129-153) (1,391-1,461) (1,670-1,746) City 38,630 450 117 0.9 0.0601 5,423 2,085 1.5 < 0.0001 6,494 1,884 1.1 < 0.0001 (50.4) (106-127) (0.8-1.0) (2,045-2,126) (1.4-1.5) (1,845-1,923) (1.1-1.2) Pathogen Age group (years)
≤5
6-9
10-49
≥50
No. of positives Relative positivity (95% CI) No. of positives Relative positivity (95% CI) No. of positives Relative positivity (95% CI) No. of positives Relative positivity (95% CI) Cryp 146 45 (38-53) 9 30 (11-50) 20 16 (9-24) 40 26 (18-34) Gia 240 74 (65-84) 17 57 (30-84) 89 73 (58-88) 124 81 (66-95) Enta 92 29 (23-34) 6 20 (4-36) 22 18 (11-26) 49 32 (23-41) Noro 2,232 692 (664-719) 165 554 (472-636) 467 382 (348-416) 433 281 (255-307) Rota 5,814 1801 (1,759-1,843) 233 782 (686-879) 345 282 (253-312) 371 241 (217-265) Adeno 637 197 (182-213) 27 91 (57-125) 67 55 (42-68) 73 47 (37-58) Astro 403 125 (113-137) 27 91 (57-125) 83 68 (53-83) 173 112 (96-129) Sal 297 92 (82-102) 79 265 (208-323) 153 125 (106-145) 167 109 (92-125) Shi 6 2 (0-3) 7 24 (6-41) 31 25 (17-34) 49 32 (23-41) Vib 17 5 (3-8) 11 37 (15-59) 203 166 (144-189) 92 60 (48-72) E. coli 1,277 396 (374-417) 171 574 (491-658) 720 589 (548-631) 747 485 (451-519) Cam 31 10 (6-13) 10 34 (13-54) 57 47 (35-59) 19 12 (7-18) Clos 1,411 437 (415-459) 291 977 (870-1,084) 880 720 (675-766) 1,612 1047 (999-1,096) Staph 1,610 499 (475-523) 107 359 (292-426) 325 266 (238-295) 536 348 (319-377) Bacil 391 121 (109-133) 41 138 (96-180) 184 151 (129-172) 266 173 (152-193) List 1 0.3 (0-0.9) 0 0 3 3 (0-5) 3 2 (0-4) Yer 14 4 (2-7) 4 13 (0-27) 6 5 (1-9) 7 5 (1-8) Pathogen Total No. of protozoa
Cryptosporidium parvum
Giardia lamblia
Entamoeba histolytica
No. of positives Positivity/100 infected individuals (95% CI) No. of positives Positivity/100 infected individuals (95% CI) No. of positives Positivity/100 infected individuals (95% CI) No. of positives Positivity/100 infected individuals (95% CI) Noro 45 4.6 (3.3-5.9) 12 4.7 (2.1-7.3) 28 4.7 (3.0-6.4) 8 4.1 (1.3-6.9) Rota 165 16.7 (14.4-19.0) 75 29.5 (23.9-35.1) 90 15.2 (12.3-18.1) 20 10.3 (6.0-14.6) Adeno 26 2.6 (1.6-3.6) 12 4.7 (2.1-7.3) 8 1.3 (0.4-2.3) 12 6.2 (2.8-9.6) Astro 75 7.6 (5.9-9.3) 6 2.4 (0.5-4.2) 58 9.8 (7.4-12.2) 18 9.3 (5.2-13.4) Sal 11 1.1 (0.5-1.8) 0 0.0 8 1.3 (0.4-2.3) 3 1.5 (0-3.3) Shi 3 0.3 (0-0.6) 0 0.0 3 0.5 (0-1.1) 0 0.0 Vib 5 0.5 (0.06-1.0) 0 0.0 4 0.7 (0-1.3) 1 0.5 (0-1.5) E. coli 51 5.2 (3,8-6.5) 13 5,1 (2.4-7.8) 25 4.2 (2.6-5.8) 14 7.2 (3.6-10.0) Cam 1 0.1 (0-0.3) 0 0.0 1 0.2 (0-0.5) 0 0.0 Clos 82 8.3 (6.6-10.0) 24 9.4 (5.9-13.0) 45 7.6 (5.5-9.7) 20 10.3 (6.0-14.6) Staph 55 5.6 (4.1-7.0) 12 4.7 (2.1-7.3) 37 6.2 (4.3-8.2) 9 4.6 (1.7-7.6) Bacil 16 1.6 (0.8-2.4) 2 0.8 (0-1.9) 11 1.9 (7.7-2.9) 4 2.1 (0.1-4.1) List 0 0.0 0 0.0 0 0.0 0 0.0 Yer 0 0.0 0 0.0 0 0.0 0 0.0
Table 1. Primers used in this study
Table 2. Positivity for protozoa, viruses, and bacteria in hospitalized diarrheal patients in Korea, 2004-2006

Positivity is per 10,000 individuals; CI, confidence interval; AOR, adjusted odds ratio; SE, standard error; IQR, interquantile range.

Table 3. Distribution of protozoan, viral, and bacterial positivity by age of hospitalized diarrheal patients in Korea, 2004-2006

Positivity is per 10,000 individuals; CI, confidence interval.

The number of cases was counted to each mixed-infected case for individual who has simultaneously several pathogens.

Cryp, Cryptosporidium parvum; Gia, Giardia lamblia; Enta, Entamoeba histolytica; Sal, Sallmonela spp. (Typhimurium and Enteritidis); Shi, Shigella spp.; Vib, Vibrio parahaemolyticus; E. coli, Pathogenic Escherichia coli (STEC, EAEC, EPEC, ETEC, and EIEC); Cam, Campylobacter jejuni; Clo, Clostridium perfringens (alpa toxin, Enterotoxin, or non-toxin); Staph, Staphylococcus aureus (toxin A, B, C, D, and E); Bacil, Bacillus cereus (Hemolysin BL-enterotoxin, Non-hemolytic enterotoxin); List, Listeria monocytogenes; Yer, Yersinia enterocolotica; Noro, Norovirus; Rota, Rotavirus (Group A); Adeno, Enteric adenovirus; Astro, Astrovirus.

Table 4. Mixed-infections with viruses and bacteria among individuals infected with protozoans in hospitalized diarrheal patients in Korea, 2004-2006

Positivity per 100 infected individuals with protozoa (total), C. parvum, G. lamblia, or E. histolytica; CI, confidence interval.

The number of cases was counted to each mixed-infected case for individual who has simultaneously several pathogens.

Noro, Norovirus; Rota, Rotavirus (Group A); Adeno, Enteric adenovirus; Astro, Astrovirus; Sal, Sallmonela spp. (Typhimurium and Enteritidis); Shi, Shigella spp.; Vib, Vibrio parahaemolyticus; E. coli, Pathogenic E. coli (STEC, EAEC, EPEC, ETEC, and EIEC); Cam, Campylobacter jejuni; Clo, Clostridium perfringens (alpa toxin, Enterotoxin, or non-toxin); Staph, Staphylococcus aureus (toxin A, B, C, D, and E); Bacil, Bacillus cereus (Hemolysin BL-enterotoxin, Non-hemolytic enterotoxin); List, Listeria monocytogenes; Yer, Yersinia enterocolotica.