Abstract
Mitochondrial genome sequence of malaria parasites has served as a potential marker for inferring evolutionary history of the Plasmodium genus. In Plasmodium falciparum, the mitochondrial genome sequences from around the globe have provided important evolutionary understanding, but no Indian sequence has yet been utilized. We have sequenced the whole mitochondrial genome of a single P. falciparum field isolate from India using novel primers and compared with the 3D7 reference sequence and 1 previously reported Indian sequence. While the 2 Indian sequences were highly divergent from each other, the presently sequenced isolate was highly similar to the reference 3D7 strain.
-
Key words: Plasmodium falciparum, malaria, whole genome sequencing, mitochondrial genome, India
Malaria is a vector-borne infectious disease, endemic to many of the tropical and subtropical countries of the globe including India. Approximately half (273 million) of the high risk population outside Africa resides in India [
1].
Plasmodium falciparum malaria is the leading cause of deaths and accounts for about 50% of malaria cases in India [
2]. The problem is further compounded by high virulence and emergence of drug resistance in
P. falciparum, and till now no effective vaccine is available. The primary huddle to design an effective vaccine that would work in all malaria endemic populations is highly observed genetic diversity in
P. falciparum field isolates, as this parasite uses the genetic diversity to fight against the anti-malarial drugs and host immunity [
3]. Therefore, the analysis of within-species genetic diversity is very important for understanding evolutionary processes both at the population and the genetic level which will not only enlightens the origin, historical migration, and demography of different populations, but also inform if new parasite genotypes of high virulence and drug resistance are emerging and spreading to different populations. Such understanding on the long run will definitely be of help in devising effective population-based control measures.
To this respect, mitochondrial (
mt) genome has served as an ideal marker to understand evolutionary history of many model and non-model organisms and has been a marker of choice for reconstructing historical patterns of population demography and phylogenetic studies [
4]. Several characteristics features; such as high mutation rate [
5], maternal inheritance [
6], and lack of recombination [
7] have made the
mt genome an ideal extra-nuclear genome to reconstruct evolutionary histories of the species. In malaria parasites,
mt genome is of particular relevance, due to (i) its small size (~6 kb), (ii) haploid, and (iii) contains 3 protein-coding genes, cytochrome c oxidase I (
cox1), cytochrome c oxidase III (
coxIII) and cytochrome b (
cytb) [
8].
All these 3 genes are essential for a range for cellular processes; like membrane potential maintenance, heme and coenzyme Q biosynthesis, and oxidative phosphorylation [
9]. Most importantly, the
cytb gene of
P. falciparum mitochondria is a potential target for an antimalarial drug, atovaquone [
10]. Moreover, the
mt genome of parasites evolves neutrally and shows no signs of recombination or selection [
11], hence the whole genome behaves as a single locus and all sites share a common genealogy, which makes it ideal for studying within-species variations and phylogenetic analysis. While
mt genome sequences have been reported from many malaria endemic countries of the world [
11], only 1 complete
mt genome sequence of
P. falciparum isolate originating from unknown location in India has so far been reported [
12]. Considering
P. falciparum malaria is widespread in India, lack of
mt genome sequence information from multiple Indian isolates has debarred us in unravelling the net diversity of Indian
P. falciparum. To fill this gap in knowledge and to initiate population genomic studies of Indian
P. falciparum, we herewith report the whole
mt genome sequence of a single Indian field isolate, and the results of preliminary comparative genomic studies between the existing Indian data [
12] and the reference sequence (3D7 isolate).
Finger-pricked blood sample of a microscopically diagnosed
P. falciparum infected malaria patient from Bilaspur (Chhattisgarh state, India) was spotted (2-3 spots) on Whatmann filter paper, dried, and brought to the laboratory in New Delhi. Genomic DNA was extracted from these dried blood spots using QIAamp mini DNA isolation kit (Qiagen, Hilden, Germany). Since both
P. falciparum and
Plasmodium vivax are endemic to India, we used the isolated genomic DNA to perform PCR diagnostic assay to identify mixed infection following the nested PCR with genus and species-specific primers based on 18S rRNA gene [
13]. The study was approved by the Ethics Committee of the National Institute of Malaria Research (NIMR), India, and written informed consent of the patients have been obtained.
To sequence the whole
mt genome of the present
P. falciparum isolate originated from Bilaspur (referred as Blsp1), we checked for PCR amplification using the sets of primers reported to sequence the Indian
P. falciparum isolate PfPH10 [
12]. However, we could not PCR-amplify any of the fragments of the
mt genome of the Blsp1 isolate with repeated attempts. Therefore, we used the whole
mt genome sequence information of the published 3D7 isolate, downloaded from the NCBI (
www.ncbi.nlm.nih.gov/) database with GenBank accession no. AY282930, and chopped the whole
mt genome into 19 different DNA fragments. In order to sequence the whole
mt genome of
P. falciparum Bslp1 isolate, we designed 19 novel primer-pairs. Two online computer programs, Primer3 and SIGMA primer-calculator were used to design these novel primer-pairs so as to keep the length of each fragment below 600 nucleotide base pairs (bp) with ~150 bp of overlapping sequences between each adjoining fragment. The length of each of the 19 PCR-amplified fragments was deliberately kept below 600 bp, as we have performed DNA sequencing following Sanger technology (see below).
All PCR amplification reactions were carried out in a final volume of 25 µl, which included 1 µl of each primer (10
pmol/µl), 0.2 mM of dNTP, 1 unit of Taq DNA polymerase (Merck) with 2.5 µl of 1x Taq DNA polymerase buffer and 1 µl of DNA. Amplifications were performed with the following cycling conditions: 95℃ for 5 min, then 35 cycles of 1 min denaturation at 95℃, 1 min annealing at different temperatures for different DNA fragments (
Table 1), 1 min extension at 72℃ followed by 5 min final extension at 72℃. Successfully amplified PCR products were further purified by incubating with Exonuclease-I and Shrimp Alkaline Phosphatase (Fermentas, Life Sciences, Berlington, Ontario, Canada) and DNA sequencing was performed in an ABI 3730XL DNA Analyzer (Applied Biosystems. Foster City, California, USA), an in-house sequencing facility of NIMR. All the 19 PCR-amplified fragments were sequenced in both forward and reverse directions (2x coverage) and each DNA sequence was individually edited and assembled using the EditSeq and MegAlign modules of the Lasergene (DNASTAR, Madison, Wisconsin, USA) computer program. All the 19 finally edited sequences were manually assembled to form a single whole
mt genome sequence and aligned with the 3D7 reference sequence and the published Indian
P. falciparum sequence (PfPH10) [
12] using the MEGA v5.0 computer program [
14] to ascertain nucleotide differences, if any, by comparing the
mt genome sequences of 3 different isolates. Further, to understand the phylogenetic interrelationship among the 2 Indian (Blsp1 andPfPH10), the reference 3D7, and other 21
Plasmodium species, Neighbor-joining (NJ) phylogenetic tree was constructed using the MEGA v5.0 computer program [
14] with 100 bootstrap replicates.
For phylogenetic analysis, the whole
mt genome sequences of
Plasmodium species infecting primates (GenBank no. AB354573, AB434919, AB434920, AB354574, AB354572, AY722799, AB354575, NC_007232, AB434918, NC_002235), rodents (GenBank no. AB379663, AB599931, AB558173), birds (GenBank no. AB599930, AB250415, AB302215), Lizard (GenBank no. NC_009961) and humans (GenBank no. M76611, NC_007243, AB354570, AB354571, AY282930), were downloaded from the NCBI web database (
www.ncbi.nlm.nih.gov) and aligned using MEGA v5.0 computer program [
14]. The whole
mt genome sequence of the Blsp1 isolate has been deposited in GenBank public domain sequence database with accession number KJ144901.
Using the 19 novel primer-pairs (
Table 1) designed in the present study, we could successfully sequenced the whole
mt genome of a single
P. falciparum field isolate (Blsp1) from an endemic locality of India with 2x coverage and compared with the whole
mt genomes of 2 other isolates (3D7 and the previously reported PfPH10 isolate from India) [
12]. A detailed list of novel primers designed in the present study is provided in
Table 1, and the approximate locations of each primer-pair in the circular
mt genome of
P. falciparum is presented in
Fig. 1. While the total length of the whole
mt genome from 2 Indian
P. falciparum isolates (PfPH10 and Blsp1) was similar in size of 5,967 bp (
Fig. 1), surprisingly, the alignment of these 2 isolates revealed nucleotide differences in 22 positions; 2 of these were in
coxIII gene, 5 in
cox1 and, 7 in
cytb genes (
Table 2), suggesting very high amount of variation in the
mt genome in Indian
P. falciparum. However, when the presently sequenced
mt genome from Blsp1 isolate was aligned with the 3D7 isolate, only 1 nucleotide difference could be observed between these 2 genomes (
Table 2).
This observation was in contrast to an earlier report on high sequence variation in
mt genome between the worldwide and Indian isolates involving the PfPH10 isolate [
12]. In any case, the present observation on low mitochondrial genome diversity between a single
P. falciparum isolate (Blsp1) and the reference 3D7 corroborates earlier opinion on the overall low variations among
P. falciparum
mt genomes [
11]. Furthermore, the observation of 22 nucleotide changes between just 2
P. falciparum
mt genomes from India (
Table 2) reflects many-fold higher diversity in India, compared to only 30 SNPs found in 100 worldwide
P. falciparum isolates of African, Asian, Papua New Guinean, and American origins [
11]. Such observed high sequence variability between the Blsp1 and PfPH10 isolates might be the reason of failure for PCR amplification with primer information used to amplify and sequence the PfPH10 isolate [
12]. This argument is further justified by the fact that, by using the 3D7 isolate (with only 1 nucleotide change), we could successfully amplify the Blsp1 isolate, justifying high sequence similarities. In order to nullify the role of PCR and sequencing errors, we have re-amplified and re-sequenced all the 19 DNA fragments of Blsp1 isolate using a different PCR thermal cycler (total 4x coverage), but the observed results were not different from the previously sequenced data. This observation essentially means that neither any inaccuracy in the PCR nor in sequencing techniques have contributed to our observed results.
With the whole
mt genome sequence of a second
P. falciparum isolate (Blsp1) in hand showing high sequence differences, we were interested to understand evolutionary interrelationships between the 2 Indian
mt genomes with the reference 3D7 isolates by constructing NJ phylogenetic tree (
Fig. 2). We have also included the published whole
mt genome sequences of different
Plasmodium species infecting an array of organisms. The tree topologies of the NJ phylogenetic tree justifies the evolutionary patterns of
Plasmodium species according to their respective hosts [
15,
16]. For the
P. falciparum isolates infecting humans, the Blsp1, 3D7, and C10 (GenBank accession no. M76611) form a single clade, whereas the PfPH10 isolate was placed away from this clade, justifying high genetic differentiation of this Indian isolates from the rest of
P. falciparum isolates (
Fig. 2). Whatever the case may be, the high sequence similarity between the whole
mt genome sequences of the Blsp1 and 3D7 isolates justify the notion that intra-specific
mt genome variations are in fact minimal [
11] and therefore
mt genomes remain conserved among the phylum Apicomplexa [
8] as well as in
Plasmodium species infecting different hosts (both humans and non-humans) [
17], possibly due to very low recombination rate and uni-parental (maternal) inheritance [
6].
However, the observed high variability between the
mt genomes of 2 Indian isolates suggests high genetic diversity in Indian
P. falciparum [
2] which can be further validated by sequencing isolates from more Indian populations. Such study would not only fill the gap of the existing knowledge about the worldwide
mt genome diversity but also help to bring out important and so far not-fully-resolved evolutionary history of global
P. falciparum. Moreover, whole
mt genome sequence comparisons in multiple
P. falciparum isolates from all over India would also inform the extent of genetic diversity of the
cytb gene that is considered to be the target of an effective antimalarial, atovaquone [
10]. As this antimalarial is currently not used in India, the knowledge of the extensive diversity through population genomic studies of
mt genome of Indian
P. falciparum would possibly help in deciding whether to incorporate atovaquone in malaria control programs in India.
The Department of Biotechnology, Government of India
Notes
-
We have no conflict of interest related with this study.
ACKNOWLEDGMENTS
Financial assistance in the form of an extramural project by the Department of Biotechnology, Government of India to Aparup Das is thankfully acknowledged. Suchi Tyagi is a Senior Research Fellow of the Indian Council of Medical Research. We thank Prof. A.P. Dash, former Director of NIMR for encouragement and Dr. Neena Valecha, present Director of NIMR for facilities. The study has been approved by the ethical committee of NIMR. The paper bears NIMR publication committee clearance number 020/2013.
References
- 1. World Health Organization. World Malaria Report. Geneva, Switzerland. WHO; 2012. p 288.
- 2. Singh V, Mishra N, Awasthi G, Dash AP, Das A. Why is it important to study malaria epidemiology in India? Trends Parasitol 2009;25:452-457.
- 3. Das A, Bajaj R, Mohanty S, Swain V. Genetic diversity and evolutionary history of Plasmodium falciparum and P. vivax. Curr Sci 2007;92:1516-1524.
- 4. Avise JC, Walker D. Pleistocene phylogeographic effects on avian populations and the speciation process. Proc Biol Sci 1998;265:457-463.
- 5. Brown WM, George M Jr, Wilson AC. Rapid evolution of animal mitochondrial DNA. Proc Natl Acad Sci USA 1979;76:1967-1971.
- 6. Creasey A, Mendis K, Carlton J, Williamson D, Wilson I, Carter R. Maternal inheritance of extra-chromosomal DNA in malaria parasites. Mol Biochem Parasitol 1994;65:95-98.
- 7. Elson JL, Andrews RM, Chinnery PF, Lightowlers RN, Turnbull DM, Howell N. Analysis of European mt DNAs for recombination. Am J Hum Genet 2001;68:145-153.
- 8. Feagin JE, Harrell MI, Lee JC, Coe KJ, Sands BH, Cannone JJ, Tami G, Schnare MN, Gutell RR. The Fragmented Mitochondrial Ribosomal RNAs of Plasmodium falciparum. PLoS ONE 2012;7:e38320.
- 9. Krungkrai J. The multiple roles of the mitochondrion of the malarial parasite. Parasitology 2004;129:511-524.
- 10. Vaidya AB, Lashgari MS, Pologe LG, Morrisey J. Structural features of Plasmodium cytochrome b that may underlie susceptibility to 8-aminoquinolines and hydroxynaphthoquinones. Mol Biochem Parasitol 1993;58:33-42.
- 11. Joy DA, Feng X, Mu J, Furuya T, Chotivanich K, Krettli AU, Ho M, Wang A, White NJ, Suh E, Beerli P, Su XZ. Early origin and recent expansion of Plasmodium falciparum. Science 2003;300:318-321.
- 12. Sharma I, Rawat DS, Pasha ST, Biswas S, Sharma YD. Complete nucleotide sequence of the 6 kb element and conserved cytochrome b gene sequences among Indian isolates of Plasmodium falciparum. Int J Parasitol 2001;31:1107-1113.
- 13. Gupta B, Gupta P, Sharma A, Singh V, Dash AP, Das A. High proportion of mixed species Plasmodium infections in India revealed by PCR diagnostic assay. Trop Med Int Health 2010;15:819-824.
- 14. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 2011;28:2731-2739.
- 15. Prugnolle F, Ollomo B, Durand P, Yalcindag E, Arnathau C, Elguero E, Berry A, Pourrut X, Gonzalez JP, Nkoghe D, Akiana J, Verrier D, Leroy E, Ayala FJ, Renaud F. African monkeys are infected by Plasmodium falciparum nonhuman primate-specific strains. Proc Natl Acad Sci USA 2011;108:11948-11953.
- 16. Duval L, Fourment M, Nerrienet E, Rousset D, Sadeuh SA, Goodman SM, Andriaholinirina NV, Randrianarivelojosia M, Paul RE, Robert V, Ayala FJ, Ariey F. African apes as reservoirs of Plasmodium falciparum and the origin and diversification of the Laverania subgenus. Proc Natl Acad Sci USA 2010;107:10561-10566.
- 17. Hikosaka K, Watanabe YI, Kobayashi F, Waki S, Kita K, Tanabe K. Highly conserved gene arrangement of the mitochondrial genomes of 23 Plasmodium species. Parasitol Int 2011;60:175-180.
Fig. 1Schematic overview of the ~6 kb mt genome and the approximate locations of primers to amplify the whole mt genome of Indian P. falciparum.
Fig. 2Neighbour-joining (NJ) phylogenetic tree showing evolutionary inter-relationships among the Blsp1, 3D7, and PfPH10 isolates and also among different Plasmodium species infecting non-human hosts. The values in the internal nodes indicate bootstrapped values signifying the strength of each corresponding internal node of the NJ tree.
Table 1.Details of primer sequences employed in PCR amplification and sequencing of the whole mt genome of Plasmodium falciparum along with annealing temperatures of the respective fragments
Table 1.
|
S. no. |
Primer name |
Primer sequence (5´ to 3´) |
Annealing temperature (°C) |
|
1 |
M_1F |
TGCTATTGGATTCAACGTCC |
63.7 |
|
M_1R |
GTCCTGCATGAACGGTGTA |
|
|
2 |
M_2F |
TCGTAACCATGCCAACACAT |
63.2 |
|
M_2R |
GCTGGGCATTTAATCCACTC |
|
|
3 |
M_3F |
GGGTATCCAATCCAGTGCTC |
63.7 |
|
M_3R |
CAAACACTAGCGGTGGAACA |
|
|
4 |
M_4F |
AGGGAACAAACTGCCTCAAG |
63 |
|
M_4R |
GGCATTTTGTTGAAATAGTCTGG |
|
|
5 |
M_5F |
ACTTCCTTTCTCGCCATTTG |
63.7 |
|
M_5R |
GCATCATGTATGAGTGCATGTT |
|
|
6 |
M_6F |
TTGTAGAGATGCAAAACATTCTCC |
60.4 |
|
M_6R |
GCACATCTAGTTTCATATCCTGCA |
|
|
7 |
M_7F |
CAGAATAAAAACTTTCTCGAATAGG |
61.8 |
|
M_7R |
AAGTACGCGATCTCTTGTATGG |
|
|
8 |
M_8F |
CGCAGCCTTGCAATAAATAA |
61.8 |
|
M_8R |
CATGAGGCTCGGATATAAATGA |
|
|
9 |
M_9F |
GAACGCTTTTAACGCCTGAC |
52.7 |
|
M_9R |
AGTCCATCCAGTTCCACCAC |
|
|
10 |
M_10F |
CCAGGATTATTCGGAGGATT |
52.8 |
|
M_10R |
CAGGATGTCCAAAATACCAGA |
|
|
11 |
M_11F |
CCGGTTTTAACTGGAGGAGT |
62.6 |
|
M_11R |
GCTACATCAATGGCAGCAT |
|
|
12 |
M_12F |
CCGGTACAAAAGTATTTAACTGGA |
62.6 |
|
M_12R |
GGTCATTGTTGTCCCAATAGAA |
|
|
13 |
M_13F |
GCATTTCAAGATAATTTCTTTGGT |
62.6 |
|
M_13R |
AAACATCTGGTGTATATCGACTTG |
|
|
14 |
M_14F |
CACACTTAATAAATTACCCATGTCCA |
62.6 |
|
M_14R |
GGATCACTCACAGTATATCCTCCA |
|
|
15 |
M_15F |
TTGTCTTACCATGGGGTCAAA |
62.6 |
|
M_15R |
CCAGCTGGTTTACTTGGAACA |
|
|
16 |
M_16F |
TCACATCCTGATAATGCTATCG |
62.6 |
|
M_16R |
CGAAGCATCCATCTACAGCTA |
|
|
17 |
M_17F |
TTACAGCTCCCAAGCAAACA |
62.6 |
|
M_17R |
GACGGTTTTCTGCGAAATCTA |
|
|
18 |
M_18R |
GGGAGTTGGCAAGTTAAAGAAG |
62.6 |
|
M_18R |
GGAAGTACGAATTGAAGTGTGG |
|
|
19 |
M_19F |
CCTGGCTAAACTTCCCAATG |
62.6 |
|
M 19R |
AGAAACAGTCGGTGCGAAGT |
|
Table 2.Alignment showing variations in the 3 mt [2 Indian (Blsp1 and PfPH10) and 1 reference (3D7)] genomes of Plasmodium falciparum isolates
Table 2.
|
Nt Positions |
208 |
222 |
230 |
510 |
615 |
1122 |
1339 |
2175 |
2768 |
3330 |
3433 |
3444 |
3764 |
3766 |
3868 |
3985 |
4352 |
4353 |
4420 |
4640 |
4759 |
4952 |
5485 |
|
3D7a
|
G |
A |
G |
A |
C |
G |
A |
T |
T |
A |
T |
T |
T |
A |
A |
C |
A |
T |
T |
A |
T |
T |
T |
|
Blsp1b
|
· |
· |
· |
· |
· |
· |
· |
· |
· |
· |
· |
· |
· |
· |
· |
· |
· |
· |
· |
· |
· |
C |
· |
|
PfPH10c
|
A |
T |
A |
G |
T |
C |
G |
C |
A |
G |
A |
C |
C |
G |
T |
G |
T |
A |
A |
G |
C |
C |
A |