Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Original Article

Simultaneous Molecular Detection of Cryptosporidium and Cyclospora from Raw Vegetables in Korea

The Korean Journal of Parasitology 2017;55(2):137-142.
Published online: March 31, 2017

1Department of Environmental and Tropical Medicine & International Healthcare Research Institute, Konkuk University School of Medicine, Seoul 05029, Korea

2Department of Radiation Oncology, College of Medicine, Chungbuk National University, Cheongju 28644, Korea

*Corresponding author (maria205@kku.ac.kr)
• Received: January 14, 2017   • Revised: March 7, 2017   • Accepted: March 19, 2017

Copyright © 2017 by The Korean Society for Parasitology and Tropical Medicine

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 11,634 Views
  • 281 Download
  • 33 Web of Science
  • 32 Crossref
  • 36 Scopus
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Intestinal zoonotic parasites in companion animals and potential of human exposure in the Middle East
    Haifaa A. Mahjoub
    Veterinary Parasitology: Regional Studies and Reports.2026; 67: 101413.     CrossRef
  • Cryptosporidium and cryptosporidiosis: An update of Asian perspectives in humans, water and food, 2015–2025
    Shahira Abdelaziz Ali Ahmed, Sonia Boughattas, Mohammad Reza Mahmoudi, Huma Khan, Simuzar Mamedova, Ardra Namboodiri, Frederick R. Masangkay, Panagiotis Karanis
    Current Research in Parasitology & Vector-Borne Diseases.2025; 8: 100311.     CrossRef
  • Cyclospora in humans, animals, fresh produce and water in China: implications for host specificity of Cyclospora species and zoonotic transmission of C. cayetanensis
    Kangli Feng, Yaqiong Guo, Na Li, Lihua Xiao, Yaoyu Feng
    One Health Advances.2025;[Epub]     CrossRef
  • Cryptosporidium and agriculture: A review
    Eleni Golomazou, Simuzer Mamedova, Aida Vafae Eslahi, Panagiotis Karanis
    Science of The Total Environment.2024; 916: 170057.     CrossRef
  • Unveiling risks in healthy food: Vegetables and fruits are linked to the distribution chain of protozoan parasites
    Aida Vafae Eslahi, Simuzer Mamedova, Reghaissia Nassiba, Panagiotis Karanis
    Food Microbiology.2024; 123: 104592.     CrossRef
  • Food and Waterborne Cryptosporidiosis from a One Health Perspective: A Comprehensive Review
    Munwar Ali, Yaru Ji, Chang Xu, Qazal Hina, Usama Javed, Kun Li
    Animals.2024; 14(22): 3287.     CrossRef
  • Loop mediated isothermal amplification for detection of foodborne parasites: A journey from lab to lab-on-a-chip
    Fatemeh Mahdavi Abhari, Maryam Niyyati, Hamid Assadzadeh Aghdaei, Hamed Mirjalali
    Food Control.2023; 143: 109251.     CrossRef
  • Health risks of Cryptosporidium and Giardia in the application of surface water and septic tank effluent in Chinese agriculture: Impact on cancer patients identified by quantitative microbial risk assessment
    Qian Huang, Shan Huang, Weijie Kuang, Jianghui Yi, Shunxin Xiao, Feng Zhao, Guosheng Xiao
    Food Microbiology.2023; 111: 104213.     CrossRef
  • Development of a new multiplex PCR to detect fecal coccidian parasite
    Manish Katiyar, Reena Gulati, Nonika Rajkumari, Rakesh Singh
    Indian Journal of Gastroenterology.2023; 42(2): 241.     CrossRef
  • Contamination of fresh produce sold on the Italian market with Cyclospora cayetanensis and Echinococcus multilocularis
    Alessandra Barlaam, Tamirat T. Temesgen, Kristoffer R. Tysnes, Laura Rinaldi, Nicola Ferrari, Anna R. Sannella, Giovanni Normanno, Simone M. Cacciò, Lucy J. Robertson, Annunziata Giangaspero
    Food Microbiology.2021; 98: 103792.     CrossRef
  • Detection of Cyclospora cayetanensis on bagged pre-cut salad mixes within their shelf-life and after sell by date by the U.S. food and drug administration validated method
    Sonia Almeria, Alicia Shipley
    Food Microbiology.2021; 98: 103802.     CrossRef
  • Diverse Genotypes and Species of Cryptosporidium in Wild Rodent Species from the West Coast of the USA and Implications for Raw Produce Safety and Microbial Water Quality
    Xunde Li, Edward Robert Atwill
    Microorganisms.2021; 9(4): 867.     CrossRef
  • Detection of Cyclospora cayetanensis, Echinococcus multilocularis, Toxocara spp. and microsporidia in fresh produce using molecular methods: – A review
    B. Bartosova, B. Koudela, I. Slana
    Food and Waterborne Parasitology.2021; 23: e00124.     CrossRef
  • Causes of acute gastroenteritis in Korean children between 2004 and 2019
    Eell Ryoo
    Clinical and Experimental Pediatrics.2021; 64(6): 260.     CrossRef
  • An Epidemiological and Diagnostic Study of Cyclospora Cayetanensis Parasite in Anbar Province - Iraq
    S S Shahatha, S A Alkubaisy, M O Mousa
    IOP Conference Series: Earth and Environmental Science.2021; 904(1): 012026.     CrossRef
  • Evaluation of the U.S. Food and Drug Administration validated molecular method for detection of Cyclospora cayetanensis oocysts on fresh and frozen berries
    Angela Assurian, Helen Murphy, Laura Ewing, Hediye Nese Cinar, Alexandre da Silva, Sonia Almeria
    Food Microbiology.2020; 87: 103397.     CrossRef
  • A Molecular Tool for Rapid Detection and Traceability of Cyclospora cayetanensis in Fresh Berries and Berry Farm Soils
    Carolina N. Resendiz-Nava, Guadalupe E. Orozco-Mosqueda, Edmundo M. Mercado-Silva, Susana Flores-Robles, Hilda V. Silva-Rojas, Gerardo M. Nava
    Foods.2020; 9(3): 261.     CrossRef
  • Parasite detection in food: Current status and future needs for validation
    Rachel M. Chalmers, Lucy J. Robertson, Pierre Dorny, Suzanne Jordan, Age Kärssin, Frank Katzer, Stéphanie La Carbona, Marco Lalle, Brian Lassen, Ivona Mladineo, Miroslaw Rozycki, Ewa Bilska-Zajac, Gereon Schares, Anne Mayer-Scholl, Chiara Trevisan, Kristo
    Trends in Food Science & Technology.2020; 99: 337.     CrossRef
  • Detection of Cryptosporidium oocysts and Giardia cysts in vegetables from street markets from the Qinghai Tibetan Plateau Area in China
    Xiuping Li, Xueyong Zhang, Yingna Jian, Geping Wang, Liqing Ma, Chad Schou, Panagiotis Karanis
    Parasitology Research.2020; 119(6): 1847.     CrossRef
  • Comparison of commercial and in-house real-time PCR platforms for 15 parasites and microsporidia in human stool samples without a gold standard
    Thomas Köller, Andreas Hahn, Enkhtsetseg Altangerel, Jaco J. Verweij, Olfert Landt, Simone Kann, Denise Dekker, Jürgen May, Ulrike Loderstädt, Andreas Podbielski, Hagen Frickmann
    Acta Tropica.2020; 207: 105516.     CrossRef
  • Prevalence of Cryptosporidium and Giardia in vegetables in Iran: a nineteen-years meta-analysis review
    Ehsan Javanmard, Elnaz Sadat Mirsamadi, Meysam Olfatifar, Erfan Ghasemi, Fatemeh Saki, Hamed Mirjalali, Mohammad Reza Zali, Panagiotis Karanis
    Journal of Environmental Health Science and Engineering.2020; 18(2): 1629.     CrossRef
  • Detection of human intestinal protozoan parasites in vegetables and fruits: a review
    Junqiang Li, Zhenzhen Wang, Md Robiul Karim, Longxian Zhang
    Parasites & Vectors.2020;[Epub]     CrossRef
  • Human cyclosporiasis
    Annunziata Giangaspero, Robin B Gasser
    The Lancet Infectious Diseases.2019; 19(7): e226.     CrossRef
  • Simultaneous detection of four protozoan parasites on leafy greens using a novel multiplex PCR assay
    Karen Shapiro, Minji Kim, Veronica B. Rajal, Michael J. Arrowood, Andrea Packham, Beatriz Aguilar, Stefan Wuertz
    Food Microbiology.2019; 84: 103252.     CrossRef
  • Status of common parasitic diseases in Korea in 2019
    Sun Huh
    Journal of the Korean Medical Association.2019; 62(8): 437.     CrossRef
  • Genotyping genetically heterogeneousCyclospora cayetanensisinfections to complement epidemiological case linkage
    Joel L. N. Barratt, Subin Park, Fernanda S. Nascimento, Jessica Hofstetter, Mateusz Plucinski, Shannon Casillas, Richard S. Bradbury, Michael J. Arrowood, Yvonne Qvarnstrom, Eldin Talundzic
    Parasitology.2019; 146(10): 1275.     CrossRef
  • Identification of human pathogenic Enterocytozoon bieneusi, Cyclospora cayetanensis, and Cryptosporidium parvum on the surfaces of vegetables and fruits in Henan, China
    Junqiang Li, Ke Shi, Fangfang Sun, Tingwen Li, Rongjun Wang, Sumei Zhang, Fuchun Jian, Changshen Ning, Longxian Zhang
    International Journal of Food Microbiology.2019; 307: 108292.     CrossRef
  • Cyclospora cayetanensis and Cyclosporiasis: An Update
    Sonia Almeria, Hediye N. Cinar, Jitender P. Dubey
    Microorganisms.2019; 7(9): 317.     CrossRef
  • Cryptosporidium spp., prevalence, molecular characterisation and socio-demographic risk factors among immigrants in Qatar
    Sonia Boughattas, Jerzy M. Behnke, Duaa Al-Sadeq, Ahmed Ismail, Marawan Abu-Madi, Christine A. Petersen
    PLOS Neglected Tropical Diseases.2019; 13(10): e0007750.     CrossRef
  • Molecular Prevalence and Genotypes of Cryptosporidium parvum and Giardia duodenalis in Patients with Acute Diarrhea in Korea, 2013-2016
    Da-Won Ma, Myoung-Ro Lee, Sung-Hee Hong, Shin-Hyeong Cho, Sang-Eun Lee
    The Korean Journal of Parasitology.2019; 57(5): 531.     CrossRef
  • Assessment of pesticide residues and microbial contamination in raw leafy green vegetables marketed in Italy
    Gino Angelo Santarelli, Giacomo Migliorati, Francesco Pomilio, Cristina Marfoglia, Patrizia Centorame, Antonella D'Agostino, Roberta D'Aurelio, Rossana Scarpone, Noemi Battistelli, Federica Di Simone, Giuseppe Aprea, Luigi Iannetti
    Food Control.2018; 85: 350.     CrossRef
  • Parasite contamination of berries: Risk, occurrence, and approaches for mitigation
    Tamirat Tefera, Kristoffer R. Tysnes, Kjersti Selstad Utaaker, Lucy J. Robertson
    Food and Waterborne Parasitology.2018; 10: 23.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Simultaneous Molecular Detection of Cryptosporidium and Cyclospora from Raw Vegetables in Korea
Korean J Parasitol. 2017;55(2):137-142.   Published online April 30, 2017
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Simultaneous Molecular Detection of Cryptosporidium and Cyclospora from Raw Vegetables in Korea
Korean J Parasitol. 2017;55(2):137-142.   Published online April 30, 2017
Close

Figure

  • 0
  • 1
Simultaneous Molecular Detection of Cryptosporidium and Cyclospora from Raw Vegetables in Korea
Image Image
Fig. 1 Restriction enzyme fragmentation profiles of Cryptosporidium. Quantitative real-time PCR (qPCR) products in positive samples were cut with TaqI restriction enzyme. (A) DNA of qPCR product. (B) fragmented DNA after TaqI digestion of qPCR product. NC, negative control; CP1 & CP2, C. parvum DNA (for positive controls); Cab, winter-grown cabbages; Chv, chives; Tt, cherry tomatoes; Spt, sprouts; Blu, blueberries.
Fig. 2 PCR results from Cyclospora positive samples. (A) DNA products after quantitative real-time PCR (qPCR). (B) DNA products after nested PCR. The target gene was internal transcribed spacer 2 (GenBank no. AF301386.1, for qPCR) and 18S rRNA (GenBank no. AF111183.1, for nested PCR). Cab, winter-grown cabbages; Tt, cherry tomatoes; Spt, sprouts; Blu, blueberries.
Simultaneous Molecular Detection of Cryptosporidium and Cyclospora from Raw Vegetables in Korea

Primers and probes used for multiplex real-time PCR to detect Cryptosporidium and Cyclospora simultaneously in vegetables examined from 2014 to 2015

Parasites Nucleotide position Sequences (5′→3′) Size (bp)
Cryptosporidium Forward primer 2,930–2,950 CTCCCCAGGAAGACGAAATAA 242
Reverse primer 3,171–3,148 TTCAAGCTCTCTTTCAATTTGCTC
Probe-FAM 3,013–2,987 AGCAAACAGGGCATCCAAGAACTCCTC

Cyclospora Forward primer 918–940 GCAGTCACAGGAGGCATATATCC 116
Reverse primer 1,033–1,012 ATGAGAGACCTCACAGCCAAAC
Probe-HEX 1,005–981 CGACGAACAGCCACGCACGCACTTG

Positive rates of Cryptosporidium spp. and Cyclospora spp. in various vegetable samples examined from 2014 to 2015

Vegetables No. examined No. of positive samples (%)
Cryptosporidium spp. Cyclospora spp.
Perilla leaves 72 5 (6.9) 0
Winter-grown cabbage 70 4 (5.7) 2 (2.9)
Chives 73 13 (17.8) 0
Sprouts 72 1 (1.4) 1 (1.4)
Blueberries 44 3 (6.8) 1 (2.3)
Cherry tomatoes 73 5 (6.8) 1 (1.4)
Total 404 31 (7.7) 5 (1.2)

Positive rates of Cryptosporidium spp. in various vegetable samples examined from 2014 to 2015 by month

Month Perilla leaves no. Winter-grown cabbage no. Chives no. Sprouts no. Blueberries no. Cherry tomatoes no. Total no.







Tested Positive (%) Tested Positive (%) Tested Positive (%) Tested Positive (%) Tested Positive (%) Tested Positive (%) Tested Positive (%)
July 10 10 10 10 10 10 60 0

August 6 6 6 6 3 6 33 0

September 6 6 3 6 4 6 nda 6 2 30 9

October 6 2 3 6 1 6 nda 6 1 27 4

November 6 6 1 6 5 5 nda 6 29 6

December 5 6 6 6 1 3 6 32 1

January 3 3 3 1 3 3 2 3 18 3

February 6 6 6 6 6 6 1 36 1

March 6 1 6 6 6 5 6 35 1

April 6 2 6 6 6 2 6 32 2

May 6 6 6 6 6 6 36 0

June 6 6 6 2 6 6 1 6 1 36 4

Total 72 5 (6.9) 70 4 (5.7) 73 13 (17.8) 72 1 (1.4) 44 3 (6.8) 73 5 (6.8) 404 31 (7.7)

anot done.

Positive rates of Cyclospora spp. in various vegetable samples examined from 2014 to 2015 by month

Month Perilla leaves no. Winter-grown cabbage no. Chives no. Sprouts no. Blueberries no. Cherry tomatoes no. Total no.







Tested Positive (%) Tested Positive (%) Tested Positive (%) Tested Positive (%) Tested Positive (%) Tested Positive (%) Tested Positive (%)
July 10 10 10 10 10 10 60 0

August 6 6 6 6 3 6 33 0

September 6 6 6 6 nda 6 30 0

October 6 3 6 6 nda 6 1 27 1

November 6 6 1 6 5 nda 6 29 1

December 5 6 1 6 6 1 3 6 32 2

January 3 3 3 3 3 1 3 18 1

February 6 6 6 6 6 6 36 0

March 6 6 6 6 5 6 35 0

April 6 6 6 6 2 6 32 0

May 6 6 6 6 6 6 36 0

June 6 6 6 6 6 6 36 0

Total 72 0 (0.0) 70 2 (2.9) 73 0 (0.0) 72 1 (1.4) 44 1 (2.3) 73 1 (1.4) 404 5 (1.2)

anot done.

Table 1 Primers and probes used for multiplex real-time PCR to detect Cryptosporidium and Cyclospora simultaneously in vegetables examined from 2014 to 2015
Table 2 Positive rates of Cryptosporidium spp. and Cyclospora spp. in various vegetable samples examined from 2014 to 2015
Table 3 Positive rates of Cryptosporidium spp. in various vegetable samples examined from 2014 to 2015 by month

not done.

Table 4 Positive rates of Cyclospora spp. in various vegetable samples examined from 2014 to 2015 by month

not done.