Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Original Article

Morphology and Mitochondrial Genome of Fischoederius sp. 1 in Thailand

The Korean Journal of Parasitology 2021;59(4):355-362.
Published online: August 18, 2021

Graduate Program in Biomedical Sciences, Faculty of Allied Health Sciences, Thammasat University, Pathumthani 12121, ThailandJFIFddDuckydqhttp://ns.adobe.com/xap/1.0/ Adobed     ! 1AQa"q 2#w8B36v7XRr$9bCt%u&Ws'(xy4T5fH  !1AQaq"2B Rbr#u67Ѳ3sTt5v8Sc$4ĂCÔ%UӅFV ?_Aנj- H>>,m*>fzp"TrKkr^r.|_&]|*vPuܶvoQ1mwVJUhu-I"=LniAƕ8"۲ k*ҿ[yu:.vUQ+)%F DHyVBk>Hy8jݹ q~9D4KRmzQ)^ʔ.J%k_tVi5NTjg!'ky|5asOȻ)R۸ߩFMԿ3L4j6dڜ#NIwUF]JqB/(FafJRzq3\G՛ ?~\ 6)6W4m[O^L0E&rRMض*C .]Unl-1 1r#Rj/&QɈ׉˩s6Rj=5Tg.y.·Pӡ:JJS:C8-2u]d&vUz;7p9 5VnL֢"y)">iי(IDDd| Yj0; LRfS:ktYK%*N2^m|&dğth":ey)uPQZW)gcC3Pv&MMWd&Ŵ۲mvTRoժM03*F3Yd6\8,\hݻ kߔi<k NTwSԪmljj[>->ptU%'LR>&EBH$MQAUx[$Z6vi&_a.KIQ{hyƒ j"JOC9eFҝfj;˚Ω<[3_m% lQ@4g=5$(J]Yc-OMq<Ǎ wSzڗ)k$7VIP붾ͯnV+卵*t]iЎD31~SA1éC2u)ʼnQn-Uoi3:grI8ؓWm*G zܕ)ZקJ}Y YlGeJ6cB2I NS3Q>k=KTBT]W6+SOXQgGR? telˊ%-Re\hѯ2TF"C/OJΩ6r[N.0{SpljjX1“jOsӥ;ҭhe}xu`Ք&.)yO̒ Fߑ.$Qw;9Iw2o+RVJMSOj[SoҌZ%;`d$blQ{Ro{Imڌ>3egf\O֝Uzx"䢸g+mv%Gʆ:|V[N'&ס-ޝ'kfE|K,G&˳98Juin/\\Qݿ̋v~Ǩ!rtWU d|E߫R4d}.qPw*Ӭv5YEcn~f5c%MTMkb-F>5JT,})QHg%{("ӔȸWMsYyWNRrkkJr0XドnͫT}r-jj,Ŕʍ\Q2Ri>v$5!]"JB2WɅ)]VԜUc8i|.jeRO6^V.¸ Q&#|ܶ-*uOG%JAtRZRr]FFG\۩w+?'zչSѧt jz>KW&ot{7P&2D;&\\>Q2JzܗAKSfeNn[jRrԕf6,q,F1tRfԗ>vֶևj-&R'Zi2=xv~Elbsvm8=ӛ"ū񕜈BȩlWau[]ٷBߨF~J!|Ipr3R̴#Yp)={7:G{+:\W}n|Q#%)7^-h"Ƒq:M*%J&$T軨I333׎g_- ucBwwjp[6i25$̏bU’ٱRv?G\~#Iͪb7<<}Ezt" q_Inw,7-d,G÷%T* Wg1"䥱kq/A.,_KhqŒxwvo u2ۥۧ.bQ}XκA$֣ +K״ZUNmڸII{.v{5z5ѮRme[moyƾd~cRݾK'j.\i&/S6f|b=5: p!6i_ 4j6=.si˧eƾtS^c.Y^RJVS-Vi3,esi08?H$GvZgg?gi䤟2adw릿:"۪lkSN>q-4kI܋ێe̊qۅgDoѨ9; #T.Q;7#~_Ufstb_'w~Xw1Xk,vcOt._}v}8"(4Z\ۘgk?J?bm_c!g{HZV]Fkk%~gEt)b秴vΰB|꽸}mp~E6ݹv;7P٤v+ri*3Ԣ|'O14_~7nP{7ZU\Vű[ +7󖱅o#:ǥŬ\|3r%TJX]V7ez¨Y]lc|O3V! R zbJ'PnGqVJ"19WVeOF埜EaEJωqCN5Z g-9[S<$sUK5b|7sn\7x qmv##FF\ w[=-43$^ooVSiXօv7iB۴yg>]Vf"r$J3""32!Zh[K%7GvNLs+4nB/B{vlsobJaҺJR:0g%&zR\ S3T[&ִor*ⷳc3ʊO[iozW٨%$gn:ܶWwFBԹjHP&z u&F2\f;ipW73 [; '_̽b;vib!oec dC-tS__$Xs]l9&z$2/N>%'[}b{h/{`{Ji׉׏ YJB/X%}.|+{(S:qz]4_Kѵo`^tY_4S#* ^zvݾMr+TrkQ g.8Ͽ^i>ӈǙvix>$o( ^qt*&t1oJVu-ql5U6jCЉmĻ*"?JT=K'O/|=Vo}l0b}}f?X[?/\JSBe,kP8ETJ==?.p5ފgbU9}ǶdNKk—_$8̸͓ۍ8Di\BԿ-1v{FF]|.^ۅ{vl12׏z7-R7wE?\nh\jN/Kձr_oBw"N QMBZqe-m:ӨSn6j4%!hQ;sv'm4kcM=!8\m[M4{SMliۇ%eֽR&N:{2A8)THLK3Zj[jPBx#BگMf:G1\`edcʮ?|w(-̮vXt,bW2;.ιNHRR#YwTM"<;mk\.foIDjmlJ;vxy7o7i\,KQŊ9d^Mmgc L*.T6tLeIuOH3SJQ3=F/ʿ<9\JM6mN6=<{xkP!F1QR[I$6ُimXu2An2yԒMU q f[IB-'䤯jYm52&JG\zд\~vdg QtHGXw&1Lw+nDEdC1w|YJmvP)HZ>i0BPβә?R:QO["]I_Jʏۍ>QKyu^bycBq4lXF~l [\*N>-J6,Gq(Zr5h]CwYӤU~ʶߑ u*SIv%ZfJ7)! FS*s_\|IŸZ)J ]ܜi4"z[+Z,MOZ))}|Ʀ(RUNIII.S'ˍO~˨rn}M)xxӕ0 eyҵ7YMAB]ӣU:/ѭ*6bcwP͵ "+qēVjŹO|GtY4V j[mLV M -m>",B$ GD1~j6O4|LxnNmqATNR3ε|DŽa[fmn-ڭ+FiK7Pcm;r5 l8r{#-]'nrFh2ruycb;pW=njRqRJ(d mnpckNnʹ+6]tz~E=ʕ l ZZ5jSi3#47.Lcfe`9؏v囜.F\-UZ:*0_<Νu9Lӵm&)_3\^ҹ3"1n1v_|uRʞͫr'iȧN_kH׺8xXrj=\МH)V\ˬ.Xʸ oVRC}ySU9/OBY먌5 ٿwޞ)rw8Ӫi5*5ZΗcGƱ !ZۄlmpjJ -l <R̵/JAպZuq\IdUS 48wXJJtcg4cI~aqߓwŷrm-v)G7yS^7H^-\mŌAq|"m9IBnF㏉9[N+mmy/!KKۉ%n +BdddfFF6FQRN-U5;Sv'm4kcM=Mn)\qιqUd9F%",6MGdT%-+~ f%+y֛^3SrF>6lc(֪vۊN;g._0Sѧ]ETWرkQKzGe9ʨsKA"yC y2\[5 rԭ7Gk5Mzw_4sM3hxЊ'oÍ5jsub )ͪ~tR2H]R͍>̋m6=%(˿(Wrr-܅y5(ܔJ޺YunW̹븹NsqK ]/QR#"ZMDfD|43Qw|._ԡSqTZBg??O Ϥ)/E_U|i}2 9Z?¹0:x'3,whǣ?C y-A~=daJј&M?D1_PS+Oi&;a @;Dž7[ zZC"bv:jjMQk$M RԸ3uA\=wI.AwC"^.{?-\NSiˏ"b}T/}q/ o.1M}R%:-ZniʒL$SgrBW*,Mw'N\ɇ{s\j]VryG'8f`}'N<*/`U숻z CwHq18J+vԕKss4R53/&XTt1bZƟo\=%nO)h$rBi-nKĪ^ ջڜlwkYm[̑+/QrZo%TQ;TLs($2C:s.%+eoNttq۰kK7O0m_t_pZ1SsSM7"mevFZ[w -FJ*T*jФQRg BSu|]g:ɵzjqwmltL.e3sRMچkSmjkmWœިm++¦'tILk*բQ D,PB\lI[9{%Gb R6öۍmX-MaʉA931cs..G4CujQտ[9 }G-xwl)IQz j Ó"rqe&=]꾧֎c)<kӳ+0JrRR3'TnXi^xMF Bު*tIL.[h"2"nKzZe'ZV/RrNYz]8죝n]Ķܩ>^Ժ]u-7^\mZjܣ9+Rmn ߑv?oꋘ?&ƪy^N4o=3-ؔ̿*`}V݁ ƒPu8%$ ݗ]wt;\y\>='OjPIp/nJU8{϶FNMsf"ίNqƹ(+ ݮF2Km |jܴZs%zf*eȫ?]4)I۵nR&FX + [jDh(#哑9q9Eծj8noǕZf\J-l&Z˫}`ӎhyrΉn\űn]9pʌӣ"׮Wt?N4_I_~54#/my1Xr*척aS#DT >q ssΛW;3oUaJSRMDgQnt:Ql,/ ܷfRqiM Ȼ>Cob;A>ڦWقM9X~/!'MW.}Vrߔꔵ!5|iB(0-zF=}okڢE$^wW~nokY߮\6՜̌{i-AF*9)\t9IV6۸5ZUF6R$ŨQIq砳YUZ]eyv >hI櫥N )&l JulwE1GDOuFN2| }馥uC1rޫV+^gdb&W[4<^e4YW,d|htͮsUM)۸8:{3d{AѢ)~ \#J=NdƮꮓ90 |1K$v*?мS ]i$J,C,SG?/_՜pMSƯM|mG1V1$~K>CSvkuj=&) -,yLjuFHK{c駗.SOua;BrSqj-ۍZ#'Jys7[g2z/.u4+XV2VQ.ޕ)$"(%)#Z7suZ%j }BǬݕe)Jvz8zJf:hIN|svO1O#IEcۍjݽ:SdὮvu^@:o^5cs>i/VqmVm]ؔܢn6'vޑ̗J4Wn@OlKbX ;n:hgJ9ŻyǑz8f܌q&Y fN0N;[69 rbׅC2/#kE l&2~èMR.*%g=Ft.%؝e8<.e=Uv{~㻏"EˑnvDѭ͜Lu3u0:U֝$[M5<:oi+V4V9 6nXvx&_ q Qqw3W:uϔ2yb/(ɳ|5zQiJ#r|Hw#.W?4aDŲ\ugWG;Cw鐢K|xg)##=O.dF˟jMUvWĻsr.z]kPc9"]R)mkfOd*uYf١RsB Aîh=k]ʳUrrZsq`d#r$/Ը3o^&lRWȍyuW̦Y4QDUMJ65ƒ[+ygk XK_±k#y:8(TJOSQhJt2.DR}"5[) r)6V6u5k:eXZmv𭤔!푊Q[qQ}ҹLE- 8qIZG|UM4j}Mܕ[Vwm{} Naqµ"ԈM zOpKѰ?IAD3Ir0'/q1itoB5{%wkOBn-ۜduqIzYK60{+DʕܞqIt";r1mG/\/ym[6JƫR \L=S=OT@Ix[TMm{>ݾտ֒ݸӉLYIx>+"JVNzx||5rI?C{oz8۹e\R-^\A2F R+N9 vlT]"ۭ d)t֞i #E2jB@׵=#/N+!ĕhx}I!cM`ąZ*ŻɄҒ߮Y.Z}='/oۙ3IpW̮hT7cTSuz9>B}΄&h!>lӵn~j˅IvU.'v'CSZw8QK3G> ,J59ٷ+HSg䧎hJdzvwv-cvxS5[̊n~ؿ%ַX?O0\6ne 6kn9.ϯ} *h 8_QhLݣ7q +=XBҲ5?[[)+F`=4 }B,sNg==u*Nj9k_GJ)+R~GSPBȒZ:(K]heL=vKPӢwq(NrG^ثϣ?#tC?.ͼ[ۅo؞y#%ǛjVyLSw%T*s92JTM%"YkQО.q)gCͲn8cgi6j1MѾ[{9h^vƘǚםidfi.^RHmg&rׇz:}݃}xT$ضk'5s-狶,\vpbPD،=Okf.c#cdz2FK5T!&)|ntD<+OŹU i-G[EE*FDfeaf2QƤM\UG_{ǹm%\yrGy:.\4wjPGUJޕUV7Do\7Vy_13w;[?c]H\$IJ,*L]3b%L{y.JRKG2sq,B6T}(#nW|km+q5] r㪍bJ@y{byz,b踊3ϻJ,'^xd،)JVw#.Vټc''ÝպWtbRؒJz۠8!o9IۄS95E9ؔ-e9JR{dmnッ<[~n${~Њ$W?&ՐY_? #a.ߑv?oꋘ?&ơ|y^N4o=3t=~7!/M3>n8W홎2M`Qx+ z qy8%]7_~540ۦ彷]Wq CѡwkďyF5Dum_}~P(5.(X,K9vᯐ?leB9;Jhm#3{CxGE-S{;@Fz˙]=O'!ɿ]' r`:7'2bЖ>Iy,/eTy/V<.H?UYY{\^#ѣr9^7?xoRȆ7EoS_&??zϾM?(~Q-K&>"~aߨ t7Emsϛ+?;fCr)fY+>z$tIkjn_>vnrֳki-˹l= t;'EyC¥|/BLwBJdgjۛ$s S1|ɍV%JI6KvəhzIlBYɒ|0"Sy0F>eo5W)O+X˻u';v)2vVq۳kۮws?UʑBǴYO漪e2MIjPAک\b1)DDؚKm6ZWΨgȕ۶yjڳ 2ضN[C[|r@9Jfo<_eI7q.|cÊV߷:i.:$ȋ)1%%)ADZCEBxJ0MJۥy(bNsKM9k43IwNt.\%N簤I'.j|ƃ2$grBEٌ\}9:v*!n7M(ɽ]7c@XxƱԨ37īf62cTTfFK]9wntQHͮvٱI/f|j=7}\_V5U^+:uljSȃY(XI.ȱmo1甅jڎIZ2>#\*:gY|4k\8ZwSqtyA!+];бޞKծË¥e)#5ap.QK^8VdU{*ѽL\=qmjnB5>{ Ӟ`v±5 ^k&O~Oshɷ,;6nOW>u6{RqS`)S%jp\ipdEBLfTWy$GIYw~䲭J.1vSY5z.V>^+Ǎvc.I[R{QsNR3ӎfhd>y?UJ*}~[e\i5U^͛E]G_FS(Iɿ]i8:4zj~շsW,ˆsy:%O}iur]iF5~3M:Ӟ#N06)4ߧgdawIotiz:1r5YDZLHBSi;NQc44la=Y kQIT*ըl:tq2(է9VO4뒳܂~2rq'nrVZŦ[t7\oլfb/mlpc.I8콚q^1iE~䰳mi[dۧw֤ICfdFeCsg:i| 6擣׋* 96lust^{%99UNRvaMܽo ammi$em4D6DD\nA%$$#}۷/ݕr99JMն[oT޲E"KTaP+HGkŴj5TM5xƱOS-k`ۛkٝWz;{kS}F;~q|~^_|euwnE'pSupUP)V]vE+t =ZRaVdG6= *.ϼnj9:UɷbېmF_tޫgHjVS'śǕًdkkѻ_]Kv?nT>)^e=Ar1'3ԔILyD?:-^in):{7.؂\.:V }#뺾.3r̸*xbFM aȵz 6SQ:ײj[ 8nn iFMw rR"5M5I旘35f^j='j:nNW.ʭocZvZKV^ɚJ.cM1ZI7E'6rg탸5oZ=[m Z`\hbMUR١Ȗĉ):Jin!_7Dй+f̷eKҷvͨBPR(V`y6tw*MRΝcB.ڭTnc;P$8nFvm4(D(R#R-L -2:FP lxZKQc6I("Km%$E, 78uXIFA$RQI$JbInG]c[ֹ:ZM+n^')JmJMJRu{e)7jQDw~%yQl}BZujSSf۩QZ+Dzhd5o%BIc'GZ?}΍:>Ɵivז-%݌J5MqGWTVʦh݇ܟ~Օ_6 n'{3~mϬj'J11OȻn߃r Qr\3y٘+WӍ'WxEs^O3 o~[|7>]]H9݇ZomT@]?5B:Z߂'`V_+/MSKX߆ޠk3?o7y:4R/7þ] iG߬aBRU&?r&/} cQߥGj2?C5Yśe7hU=?+ x龳f-܈czW^7p%-(\D4h{UK&ӡn^m]Fݢ:`δvj俜F+) y[{{ 7 tu>gvrěOj'5 iRg[ͶFjGe n~qT$ci ۚ0oԹc*jL[sVWqj\ݻ&6"WoK:cnWmrv)o>66(F>=W^bf#c zzʞtپy%mՉPël e}J.\Zk4ttt>oEM=q)hJjI=ͥ(%]脼_88ф;͛gWG;Cw~˘$4=uWdĜTثNDkiQL9U*O"4XP`02,Ge-k5$h>ܼ]3vr6!9RQPIVSnM(ۓ{>;/Qͱv{3&-[rc)ܚI$n{Sv3[j00)-D3z}MRzVQпj,T[uVs0\}Sid;r(ݝJ>æʺL&c[jPK0~d(FKÝW\m]GTcF|Iׁ)I3~#oX%vҦEݑؼ5Żv2qAZTE^..M{ʐfȏ2##.R}*KʛZz^ӞN*lPťLf\G6[WVQquV]XAi)5J!,$iJ6o$tPZc;Kjx_n3`qIelV~vLy{fn匋Ѿn%;zV.n'-ұdd2߽1bZksPe3TI9)$ԩIN9Vơ\=2885N\ p)/a柛w9g_lױo8ݷ iixJV& ғRi{N^_oAŮE6Y7I$Nk$|Q)-*4Z)^¸%4Qm [I%.c-OV+C֧R#%ѨCe3i;w$G+_dy| Fzj$DI(=OA gj%v/]8qԯNIS*֩',Q%\44ZZ%D|Ǧʴ6&vֵI$%8(ԬƾS&#Z. }6z?b/|Jl{ץv&mpx4Z$”ڝ4-H%dGKfM:sKSRWeJAn]>s6应-W9'H]'uȫYvgK^\czp|My\鏩w/ËQ.)]\QiS`8uL뚛̸=J"ܻi\å'-)54Ue]:K\퓡vK xwBqrH\*֕TnzC.mT=t-H]SČ~Nu╏NÅ3f|͡G~B+Xm[Q7U{9"~jgK Zoʰ7"qJ,ekSeNGgϳ] ^.6:s}_,%eRg<5⿨z{ZPun#jRІ.6g T.!]xa c#jN$Zpl̋H WZu8WmMRýsĮ?Mco~sx TU҆Q :KDG4n42.<3/'^?6/ܠڒ^yrrÿr2\D}}B]^E~^T cɛ7϶Y[<֞[7d}2%QPqOLEQR\CIsj1?\}%tJ0e~ *sk"*)&ۓEi#{1J8Hrt|'ܝRr8)=ƔN'RVz:cf]F7bZyZUȘ4x8,#JG̒?.W9XnO]KO]%]ƻ O5Γ/3qÓj؍/r̺rƵ 5\&m6h.xoeX[=<3%< lZ"2h\Z[&jW3ejm?k&[]ųj+{N{66leu_+lj]q* 7g*knأYv= q ەdxЬZ|%GUrQ3jLŒqET]1% qkXYūYc[7Ś]QY\jko\</Lc7+'hMSUc6qXyؙ~6#ѯv.0$BQi5YyIhɍiy=KD!n3Vm[V%W-B%swa97ajۗ m+9~]fKq|Ddaˑ0A]_v޺mM5* F-BYHJ5}q>ʉ.6hyDmpD׬'-_v5;5[8K[viJ.3dR:oYHHh9I7:۽fi+wm^ [)odPѱ52CZUJicSw\&_s0uBȍh32džzQflcd^m|7GѹE!fO5]]H9݇ZomT@]?5B:Z߂'`V_+/MSKX߆ޠk3?o7y:4R/7þ] iG߬aBRU&?r&/} cQߥGj2?C5Yśe7hU=?+ x龳f-܈czW^7p%5|Y:SJE\U-(a_cƣUǽXXKiȞNlmۊڭڄR!**ܤMeȽ$|X5(Ź\rJ~ܮ]>'HB0cp XFr_c?f?7<ukSgov¥iG>>䙗i.+t+bOjIܶ . i^:nm}s}(3>NZ$2Qg([".>i.ƾ)B̋M8+"- >eE6DݥJnJˣt׻ 5.˅nJGwZD~!i۶a,Db3ZQ3O#KO5/֍ozuK'GbRi᝘NV_ҝcvם ZoX}F6z 7e5_e:ۓj=AB+iܔERadMBq*ԯ DwI/Gy*mĥiRKg6skY/#SN4e$-yXM YL?^ĸNNӪ{$r1JJRSLO]Aqm>V/s[~i/j+m>z}eI"Qvp]{ZԼ:{vPAG2=T͡@ڐ#u"E*>C;o$~C#_d/HBq^YRٽzIKbOm\~żjFFGdiQ(*/i*#.FF]©m=BmpQQQSP&Ҫ!T&^>:y)$ˑÐFčI Bӡ-t!bM WҦŶ'UZ=}zvn~oT/\ǒ'nr8 AJIӆz<^uߖ4eFC1i+v!3qNyߕni?4JZlmYFXFۼO0B\m[ tʄU3s"Sr(NJ;SKW72L4̏BVdf^Ҹj\]ȱ۪(ӷm?J-KEmWڽ^4<8qu%9pŹW~877ܾeVгS(յe^C]yX͹! םm4FGȋ\y'Z FX7e)|Gjt߹#gb\ŧq_([R8[qU$Z (ʻezV2V!iQ,i$JE˂٩ a(GK'O{vnBvryRd-RK4=qxZJMl_CuuIz @Rt㮽޳!|68\-l[џ84-2Pu" RJ_^OL>G1~XnBŬw6J0*Uvlږ1N G1q9IUm*'oWu][&UyYZbBZRZNfEJf"+2nF~Eû7n1xv.RUM$6 lAxSQJ&n5ܞwlEói"#>4׿Q.nEq7Oko[1wg8ZQwZYiqtm&~">Bo?w͡ni2峋NCEy Ҕ+%ZJ ʩq*fpˤl,~^Mχk1+:ݕ z&Y`KLӪУDr3[*Z :(SL&ݻ۬Vqsyԭs x|iI߽zZrg.:mp%6ԜvgmpIUt;QbS.Է) ǨKSV,*lڌ|5Jt3#NP.=+OZ~/G سIgbꥹJnl_DUM\iM!֔wVZuԺ,yV.Q>f v:݇WiaŸN5Ҕ[M7SsrvǣrMW= \8ZW-jsnڕ.ZnF2qt ً[ٻޘY۷Zm"Jxr&NAfA-݌to9s359݆mZ+N1-qS$D=17 x׵+%_ ve4ir6Z$FDڗnFtOr'7'{9C˨ꤡaYoace{Refnft RR"4%ʌm:Sj3)OdInTO>X'vxV#jܮw9Fog;5.~Y5\~18YQܹvj4+~t7S ﬕs %^۵ڴDZV69R^Y+rj$ԇoJKR5wB9C>Y:l+EǎS{ʲ{T6Wi* ^^9k/y/Cs\g*qڵgn4T8mERr|Ti+iPe;;.i\EBEJ 丬i9ɧM-ԼsGDrZ>r#R>~X9y4b棇9JwV۔%m(b[Tjvl}۩~nDԺ{Zo-YuK1vx.nWuO+jN [ٮ0%"΢CdTJK-RަH"$I(*ve &҉FzB,_Vpqp9m8werv')E;o&QE׵^d9˦j\_,ڵugZȻ̧8k+jK{wmr@3ӭ2 wFkzFVqs1؛.v'I%$[iT]D5Dl2 nk7qUxԫLS+sا3/ΖeZYK<["%-g/kRs:f3;*E ت wJ%)5&+&rw*霣i|sMҴ|;R+fm䡩.!**dӶ-6s6,]zAXMWjmnz%SJߴm2UXw7MQ%<!tKys#P,W>s;3IYwx<+i_\\\U6 u7P|xbn_k&ӓVOe䦒 VUr,-㘘"-LZeOSҠթrEvq8Kf%5%&K"#%vD/.ZYYŏ+p$nZkvއuW9㓱Z G wYIFyf)?ƎUm5ԉ/'k84{KO:rQI}XRuԪ|*lu)3qZ[mSm5R3".Xcَ5c®ࢫI*۳~wRϿQWޝ(EJrri&ۥ^ʶ齲Im|[yb;mnm֩uiܘq>E+Ikx߄3r33-5𹻖09ϖ9[Tz~mr5NsWl$oPusޛ^{Z;);sڹf\3oٹZmԉ/'k84{NO:rQIBø8Bݱ3n֤DiK4u& ofSȒܩx<˘|N0Fչ]qsp"}! QWw@t4ӭ+cO5%]'*{eM߲DRO1y*q8w++e!c߶ܪlZWّM欼 CQ̼빶lX{vib/V/ ai;x6~]+z]MWB>re-:lgk}պ!#9?%܋V-c[z!W?c7YNm/jRr[HOzԻefճ0q15Zp#rkQQ0tU-AmڵP/cȕ?0cZYj;:0ZM=D6g ?'UN+ձ[K ܖB2'xq9{|۫N0ku 7xaj;n\ 2[VznMlWiKbSk))f..)Km)&bGZ=>OR܍W:j'rM'wYz&/鶧{Sʵb"vջq[I-ՌZH._x*BagC'T(Q:$ͳQcMCKy?3g'ߝqnT);qs #ؤZ}OOI:cfnc8W~qy.;^pVl]Hԓ>^H^@7-AA܃nmL(uWܻS߿ Td95Bdh4t6*dDh!EhI[iŨ\L.&Nc ܮf^;$R)\rip9I|ٺ?#R.ZDZ;/]nݻqs\QE9M&Bd ]N mN*D>tgbK>+ˏ.!23]BȔR1ɝ^j'k2ƮqBQq[$di]icV/e`޵B.FIIJqbi>Ӥ|p; 6${)RU>_e}^dzdfzi %ekRVUS?6'hׂ)5.\+qUgzE2C˷ecŏ^֔ibk shesFWJ#~> Wk~ݨ}ڶ>ơǚ)׽ZƉo~B-ڼrvoE:Ʃ3ۣK7+Y`WirS):{>ڛ}:wԨ(J_";6R%[u&ƫdZ_\'np| RJwNeTW,=rrbnkڄ[M3ܴz)3- R.?:okۼ0TU'w{6&w7j1z3ON'fGoO?)S_bQ_¿R(^ԴԴG.EtMڇ&RUiW uQjU> Kiu1d<ѥIQ'RQ1:O/lŗᏩiʂv&Jc{D5 Tt)1.n[n۶X}RjqnOʽ(~[Ns{ސ⛌uO,kgo֢dRNQȄ .'6W!׌P朼tdZjFGE"]K@'i۪N;sI[{SOzk>`rRR+!σj8&TjlvA̷Q?HyjyLHNտJMjܶT۽lG?SnKN%<‘ nq[N0Sq[Ta(&t(|HGO~gvkݻTR4&Z$#ViOY1r$6YF?e4U/Mvxų:zbU^gQQ+NW_'4jfz^c'#`rvrڡ(IJ/J ݦ6 ]-CW |_{v*_q3^DZ}Ic6Uڌ8p7{crZq5ki`)mU6|-Z5^iEz3P=:Cu7DF'k%}<C-޹ֲ̱#\,(f88%X-N(ck0VLR~} G"-8ӏ/ϰKq?(#nrVTmZ;zióM4 m |UT'C^_1X.gXM{%ʤd 4\ovN":"y-,T)fLQgۢr=/CƹǨJVr[a+!rT|%Y\ٱzsS>jͱ.oOc6f$q% ǒGo;n[];ߎjrk{~\VۓNIGn:iqxo |~t5)Rxעri{Vi&NUOl_ѮMfsޕkЄay.0P{7N((BaIP$ K"U6Gl ݙqJRu+qN$ m#*p<|{:>-Ev=86N*MM긭U*uѾ?/^o7;'u,h4݌xښRM:5.(/ \իU.{F^rmF-Jɷ.>Q"[4xT^OZ~mK}T0ݛ^SAo9u?lX(' qj%=X}"^e4wˠ|rܫ 6I\Ķ;Ӻw!'ڍWg{ i U_9Avhۣƾ+:vs/MK[ɭīe{`Zgb}r[i'GE2J7Nez579wRq+Un ]J.cJ4M:h箽Wxxm^ pc\wcN%'My $$| :$Fqɏ¾^қP9J6Wxvu}ݵP>Z'FFdg"-; [¢cmWkÎT8nG%ݣ7*\խCLRYZͤiD&J#'ehbSyXK|y*ӞpS̍R`[pTr/Eg)K+92{_ n3zwz'oŸۤ+sOj J:`T>Cf*lwd\fYOP"R E֢̔L4ɥ :;.b(B02rJ蠟9>V'9M%)IqnhP<%,r'P/vNSwr#w"ݨaqc(|{kd=^0jTMR2ULNz|.<|^PfY22##!,K~E BEJۜ&jRNsHަޛg\r,v؜.jK3)[EJ2ii{KEiHP^&]Gn8x=K}Wx/KI9-ϵwQ%spܾ[^R}S3$qvq8M[ ozKxcqmJ/ӿ{_}7&ݨ\f6ZSyQz& 7ۉ[8~UNn|nkiTB+4RI8'Nc%tn{!]Ȋo.nEmʱn𵵥J A+wy#+ikǒڂ;՛s85'KmE:Ђu""Iģ5p=БbTY-ͽڔ詻ngL2Q}$de# fs^o{DUUsfwӶ;s1T,ǤtޒQ\෼J=.tKU,7čJ5 N$y3kdSMQU~mO[03 $zAڟsF5^뜞"Կ QHmrR"ӳηer+ҔZ]hE-6Jmt'ޒ=O[sQj)6K}?e4v_KfZheޓ=BV[bY}lݒTTЬ{ȫvO_qpRApVŗ 6ju=*BR)g "O1yhb=tqJ gtm\b3RY+JQ^Ō֍\յ\>+uSi{=x ^w;uӘ#ĸzLn*$anok߷CBӷ}5Yqvdž<( "_OWit5:EZj2 B ρ1̊fi[n!HQF82q1牙nqnEpT(2RMoM4ϳOu ':֧_Xjsg jP^(ڙ{2%E͖j^}ZU[Q$'U) <܂%!s"m R'G5M0<+zM6qYm$ڕ$3ǧH]?o2N<8F1̻r_my[Rf59NjpzBnl7*{.QP 3N&^BLJPjAHCK2Q}$#~YMq8 k(MFMU)8MEqTy+Tʞ-ar5yܕOXw!e;q-Jqܶ䓊Y:LC UE{/t>r"lI9)3KJjϤA 6SEE$d߇3KG*En|P\ԭTn6I-ƍKTj<1H_zwGr19wF N8ݝ+a9ɫM6mhePi%mmD! """"""*1bRKrD"vnrM۫mmĽm]ӡiG~e"˩ lhRTMk^MX["Jݱk7_ޕ*DqĒ&flՒ}`W}~SմZ{ĕ~wm*/{{ѹ_-0ط#P]xlڱ~Tn5wi*lڪ (JxioϏbqKYR|!|KN53 OS222$jzww%i}>N)E+rۥ7c$Ofl/LNث\6H9: FY󡈾I)fB֔JI_ ֣^: 9mY{66㒢7Uj]:.-os[R&gMF3˸#໹kmjq^8W"PΦURjʄWa˧T!͋ lW48JB2ko+ /Nw QwQzQ ے%$ޓ7^YL|r7!v%Trܥ &|M8~ybrn[RV gSn{{*#2#ԽᢏӴHak" ӌcwҜw&RJ07ױ>Ļ =^ BɆ)v32.M1=#6%̠tҤnzqMwԣ~s*%-j|_m*.Yx9Sz=)qE4 3pk+,`=kNRڥ=B=nŔNAx)Q$ԩȧ4z3t#Z2lҮYn$S%y- JzGpu|LBV7ZW#;Wwipܷ%(6jFG5#{$D"uۭ~]֫SrD܃fҎӾ+Tu>-ZTQ& N|$沸ii>eRWݳu'[O̻j8JۻEѩ[]vni= ڒ,[_%kC7I3Nv$4ɎЈeٸoUu:[}Do5|zNq=Tre%ɧ6&~DȍF]ƞG5q m]/w/ \ʲr8=oʔe9U(W"|S]uZd#?Se[W"ֿh][-7Nu:T=)R}.;ml*5Dlf $fF(̏T hiIUU4Szɕ t(%_|2 ~6eM;TƗK[f&]LK^CE2[ȏBOd;Mi|cx,^6;sیGpQ\NuJIFTJ~đArh* B"$H쉩eXPRj?sl"ԥ)su]xpԴY%VESH"ЋJǰ K&5^Ukzׄ8kEgS2h&Se\ Yl]WҶp-ZUvi7QS:4byqOo+[̺腋[6-_Fo.6[7$p&^ _GZԸߍkc.qqoI[9m߸YxOZЦ1uoiSH)P9Uʄjcq= S>֙NeR><;+ڌk%_qT].srNO?s[=vH[]RZHRMtᩗVؾ:/~u)ԍdg%=edVrISb{6vSu=(ܥ)mTv/J}̇8 S3ad:^hBSf؉OɔLhI_1d8,L><_A0y3rXq"'(۱;mFNII.v5_(^q~X>y{3צ I*Vܛv/jW' T'NR'j%ꔩ:mJ3SB}΋!-H-RJBТQoedi9tjENenPpke.%4]#{:>mkEɱdYWl\\\'nRM4&U>?Ќˉk÷!𴪛]]5}UqG~ݏI"O~s6(Ļ)qO~h}uԕd}Q~G,oE!&G&/]_H-O=o{k\̭bkv.Ô܈+;arZx)m?M\3lU$mk-CFXjTv6u' g:Vn_*qk:VC A%'4JV%EY)#BғO4<e׿jQQ]yUr4=wm[K1r׵%Iũ-O}|kC;/VcݩWZ)EHdžTru]8hgĵ-;=>U_ InvTm_jBM+QiF"9*{DI/iuo(=TzϖmPQl_v4z>T*ȴ>YF;ε\t]EH4ꌇ[VrLzef 2T^V>g2~kg5~Nק;{~Z~W}&ŒBӿS2$J?~(Yœ"˲ߩ\O]: J׉ښT{mmIѩn3˧)4LdFZ/zUG>U> n 5& ϴ-KJi2o]uKljvK3$bԔҚV旧iY5.ίfi96v7!v))FJM4{jG~Jt/lUE%pTAFe4qQk\ve۽/u/Im+W')v{\-E|Pms7߮DZRr۞/mu*1ՙaB܆ -xg3#6ۥtRogʌU)׎]ZҞNnŞr}F1Nnޞ;cZ{N}ۿMiuxʉ*3qi'9KHQ$WJxXyرŔe~[v5~/jN9Q4o6rJv FrdxM*iRjMzUinHdн7ᾞS=S'7 } ̽zt7K|_g J=Lq+/Bw_\ۧx\HJUPzQ<hqF[V0x==CsU7q|^ {)Iq38$_A(VgcKu06Ƅ"%i~_ˉk QCܣB8Ku/񋇵u([w}$F|8TՠI.E !;RJ^}MɒD_q2];Ɖ{5}*n7nEInO{Mwv}&q+v [V}Ĝ@%>#dXQ$f;iep.GquixVt x6bj͵mlKقQ[T]zs/&yەnM'W}!Fp_d^Tu N{ɻ'l{խ2.sTu{W^H&;1s)Pӛ6>$mě;Łnj= fLT)>׸+qReɴ[UR\L*P/!$Ӊ3Q 'K=m~6XqW3^W+ųO_[F$rR*u"T%@O +%# ]˽!aܽz{ͷvQh쩎]hGތ5ɇ*DzJDRNLi 4:{~2FmXY-zzĽ^f=]uū{/+&c:Ma{ĝDp2m܍kHș/(--m_vݮK(V{R}.k&yƴ7i^4@3f sK3^Ř˸B=]?gt5KbZB<e;kQLpxuWC}n 5ҴepB##~q= `x]KWF {GfŲ}?G.I9pjWkU]>={7q{kO/^I3==f1ɏ%nnʫ/Zu_yXN<57ۍ'vy/"8넭M2eԷ&Y,в33%IkjMr7xf nmQkX4踼>a-GcIeތw&U=-:qnW)z¥j :WqSZvԒ#j"KrIU)%qrmRoDGQ~SYRsu*V)  ,/x)MFD6O#]z 96[Ui(JRfw'y$GeUީkdMF-ݻ98F2d[o{Rn0n-xsV6Dh|Eb2E:KCOӪv4SJCr"J!!m,hRLD| ZYFm/X~ΧfrN&4Ƒ=Z9Mh.Mܵw/BdrܥniŪ8ɧ|y%œ[M=_tj?F!z5\evM:\ ~F-sg钬OWq“iiȍ<Gi%%n2rqͻllƑ)okw7}\Uk-:&fj솘XerV9yZuʼşdFC=rmo%~ZN78X(N)_7.Εn1MpJ}62jjJdI";R5&iLԸc:jmqiQj$ujp\{;v5B񥍪Xn Ą4qOERjzN(Ga٠䌡)p*v(J7#ZۻZ8O W uONb+^Qipv9GvֽƼϯrYƖKGJQDNPhRJjᡧC"21"9ѓS1;R_O7/WGz)8fE%F2ukmvSov/iZ&/]~KmI[:^~ͤ\kMi稜\ywJt3W7 8Ʒ~ݥeFgѼw"8VVSج\뻆}ݭ/J6Q)d|)zU3>k\L=;ow֯gN3pKѫ|wmkZ$z^2R:E)f>ς нd|#׆?\ǔpV{;\$ƵE%-ͪm0S6[n< kE[}mvE4DDZ^$OZ0*$~XUv҅B@^?]so#%ojw;Y#SxxueBگy v^i-)s)zV jC{7Gt.w3v,ygg8s]aE_,*E tY5k٨h=o"m泏:\6w噓aiL׎n^c\75AGkЯ0Lf46َ`egZ˓p/k;̛]kq!ݸzpԭG"}R9Ve>ˏHUjJ-&7nrnwG*Xv\˱/vN}O)ʼn&CV͍f̵]r\PMB-6Du-#RͰtRN^)mT _}nSȕC*_xBuTkJW[`ɩ`ejvsngP ڻ.-WUtܑqԹQj)t;vN&RNũT+8%IXӃ5fK՛-d9 ]CƑm|nZ-6=Hz,*aEm W3VzRšdY~Xf׀Xx"]s;)5u*ُHB BRGS6bݶؿ 9j[1*jױga7oX CUI%0v#~\-O-Ꙛuɷ쏪&5mY٦M`LJ2qK~HZbr =N'YobI. (^ ׾{_ ?OJ`S`3BN[}5w6:ǵ/iSlt=4F*d&T4y/#. ɵim5Uֲf 眕6Y7 fơ=3dϕq뚩$qTM-%r!$@A? ޾V0c~{[{;򥧅a~ڵ»&ڄv1ek=wb MLkNAԬw-x>~/r=e73VeVN)K%Sښe"+3uXuچrn ֺVzscJ峻m}vb㶓n\YbIUBT%*,0nov=;z꣓S/nSXSpl##k9mXGrZv^Gde!ŷRԠzQyjC]`gToPov{j~KRBMY}i[߶9KL2ԉO0K#m>wB[ٍ+n[[b٦DX ݲpo] [\m5qdT()mo4Oy9Ie b][wղmM~vmi۱~t \}$яimRk(L c Cvk7r9_r1 ;zv|F@KyZ[&jEji/"6$69ml#e]9s\{ScL}Ȣؿ0q/nZ*t,CLoD߉Njǚy=Pgmu6^]l-["çUʖMlʍp-"qmU>۷uFOJ%Ǔkx 'g=睋k[3u,{³WɘݪF]ՍeFX"Oy\,cچ=w/gn Ļ]#2? vqy-gXnR.^}ݺFs{ŝG]}e|#0mjx"ƬWكm?rgU^xVB":Dt>@LRbun~ݭ,w+v⪕;\U(RYa61>#Jm˞Μ9g9XKaG='u8gf}'qy#ɉw J]We.ʲ-<+&q%s?2dњztҼn`cΤmmqMdz O[-ߩӲ&;[tmܝVnr">{x<8U+p:Ig]zjGkt,uzf}dؠoJaکqEq -(:d<պ=eKy[˗^%ZXkX[C2߱\ITTLGzANM￵i]K>UsOGDDD.ZF6* ҃V Zhz{'xp^`wo8r0h ZmJ5"jb[l=yUu7-;7IT%:jFjߖm0tzU'K)څNۧYJ)4IQ}^KWm7kSP>q;ނ#)'n7&׊r?óM{IwR\j2Qn[v pe#/tAF\ϵ225q֒om6z})6҅*oqDsMf CNIN=T S2t,_ѧ}kveMF0J\Rnnݙܹy[rUc-j{yGtkQ%s]5qB.Nw.JN1LvR Ui5J ZESQԙr):MJ+g}χ!2;q([jAud][ljVK3$ײSJI=/|&tl'*n۽f.frܥ jQO8>&Z];.|7T/C}$ڋUmP2Reҭ8hFF\L 3~e v\۫]ݝNmrnB%*]Z«hKc=BTLG :V74$=Ǘy+EX'4tn(I:Ѝ;Df8c,k1%dJ6.j6ź{N~l6&*fœI7 WAlGOu-ҢH,,(ǔe뿋쩨kM܍ZſgRvQ' 9)?n|er˭|I|-fGK.rΛp8XV1%K6mvG+tc+qE&ǸC_Nm:l=_/m5^[dߌڇ.c<%:)tQ$Ow~-aY;UJ>=F)2[nk؆?훐M=l6[4(O.]2#-H^n#->&mp5~Fӛ+|| S,xag%qkEUzUgæBhߕP(7]kFnq?֖CpruZ6*rEڊtS|*tI*E}7R<,nUU֫^I7Q*mSly%rdȓd8hE<9oHhMfNSRj[i7D[Rj݊+kდq{"$$H?p\̅S?㭻;t~R߁)^/>Qj`yt[w ԛ;²~+ߔ_ YW~|o]?x^ᯛ `ʼn;g)T@vWn]>&4lp+$D̢1l|ȨF%-}.9[}w~ ԠLM9hСablfe&QoW!s?wjLK?s7yO>(=C~_nyǜu?v3vyo oI@qV-jeES^[9WoSܝh"l2C1a͔CiJ@3:Pճw=/7ovuk+\V;lDgն<[A+rX~d;m!_s8ݖ׷;;.0llUC+?i#_crʙ1~C.\–q ul8Hܶ2m`ܻM3Tov|Bs rɵ"oLS- DКw=Tv@f'6|YlD͓Y%׵-#Ѯo%:&!3o%\J<02;K87>^vgƓ# ;ݝmz^Y6=PS39U%~ &f# }o!muH;ʲŇ˷yvP+&.7e[3'vR4Yj̗IZ`e˽3o[WU{ m[sUbۋZǾۆl6~9'V*.\S2<Sd*zY[aŶ`]C$n.v^Ʌ dng>ەZ,Mmϑ :n6nϦezWqUJ4! ۇ4R! =>>Fn|Q[{pRO17ƕ~._I''00k=b՛o}Osðc2'o\3}ݭQ^2 . R1yKȣtAݿ-uܾw!`?1Whn|gzUo[ECWwjUIן)^h#1ɭ!/Z np;o;ΗŻkXs."6E`Z1 עӐ9Kl8qd q} 2Stt;#j>;խabONŗ=fwP1j)l6J̶|gV2`y/0E˛6+ԫ1? 6}KW c\KoKͨ2ۅFw–s*TԞLיuDx .kCzWXhy۶gLu|%TnupǺl-S* PRaLnT+c+*xl.v!.U=|; !_L̎뱚U=4hm:ٯ"y)$:>%(n}X'p[ȴ ^˒4kƓmzDx \ 'NqamP7nyN݅=j7%McSڵj%STy qXymvCg{w/w=wSW5r̹u erծˊsOm=DhEҚRb#n)QOxtվQwe]I}wCa'"[ۂ-z}2UuKP$㜉ԧ:mc<Ý>RoL?wu|%ҷ&K y_!y9 ??:tq3(UU-lkS'ɸ@jdzQˬR] EVPW1DJq2n:,c|ǻ̑;y{X,ۂ.u.b˕u.tKBjQ"[S園S`ٮdNبeJ&9Ơ ~0a(Vm٘L+Jr*vڑE( x0+tp˕ n';wm-ޜMOxX>{#2%jgb2M[`K*\5@8l'e=0u+w ֘鳾{y܀:R*Ya]"Ӧ%ktynlۣ65,3gU}{GYrb;ge'TKwǘ.,rpܚV]Tr,!dp /ԺU,xՉ>s׽~W5oTh yx?xrrx?)?ilbT׬,z$Ԏ.UH٠\U1pU:]JwSrGZq8àd驐,N67QYBӢD㏙W!Q25ϸo9ms-7-%3CihO.J鯽-;MZM8ku-7k9S$8]q2E(}bۏI[DKOK}3KUB^u %Y,u.-&f#]'܆o$x`Yu,dzwM;#oKxn;\[d7}Rb+*Y䛂ZuBӱl{j0O̓}LhK;[aֶaGL{Cb#S.T[>߃F]NK"u^LUʐ_ykW?!GRj29͖qa'0[npcDvV)qz9R)PۨM^aJx W] r>];eN3vxdmĘ(5W2K1䪖weF{mE/QP6\u54x5[hۮ-Nk”i[lUgL]J}5 S:EhiUrgHl!ŒJ$pe=q^b͵Q' ?6|R\,JA ڵ"TDꈭ:ymg`B5t%M] <N_zv2_Ortٵ/i/ReӮ*7[qүqEG* m"[I:6e^p"I$jԴęh!m)]GZkcjS!{e^z}+Cѥ9;R|/ֱeiUԏCNu2Zhcٗg$ݭwvr P8*7/Lk~I'Km1+MW%Bk|oOm>-#qj*|Dbѱkn|n{v#jĮqNpMIUm(7Liz;{ҜݞڝVƚVϬ+sO!OstGvxӉ']uӎ4g_ 1^-8ۦ k!)Ύ5O;YSB#2Zzχ;<.ֵOtge~.(RC#wFZeGZٸ6FFJ4e2ˇpJT$[wgV)q6muDGJ56q\I!̗ y/I~RtJ9kJ]Iy*'FN0s.[l!fw'y(7$œ WƫgyΙdMEU JQJv̋vmrۖ.jWR_M֨djYgSj0^\y'EoECjm$ IƩK>Z28J2TiJ2N#}.s cArl嫶nB.FIJ.)۔\ZiM>/hLĸ=C1s[?YMqp|94- 鮝𦔽/k^#NT(Y LS$6˩}{;5 )B۷W$qpN)qqoot}ZDVә;7TiK|6f3h$dԄ}fqݡ>Nb򗉉+ͶO]>ߡ_VtYf79ڰիF sq~prս|QM)g%l0ocJȨHz V;Bb/kLAcfPJ,ԭ{ƍgpjNR6VSI*$!yV足jᇑ.](EܣqM\qJ2eZT).<9UB/(B0j)mtKEj#׿fDI-=rZړj|'Nڤ]k*i$5qt"ݙPM6E4ke^Z8ۏhz$Q(R Ay2zfRñnpnkbkI:=j &ΝșW?׵d{+ύM'??XqeeĽ.[o=UxFS=ӷdZwenՄ]_X=ĭVa* pKs0ބۍfJ3 gz̚i|wnxtjc¼5${(1fXQ65ȼb̶Zkn>%FQMJXӡ{TZEVNᖣimT/37cNJUPnP҂ZOE~"-Rc4^b- FEͧtf5[)S!OZIښݲ͑;tvܡ+N)AR=hCNn;wL16-:特7M$=Tҕ-.R[HٷnXk sn[ҞD-0WS9p9:-Ϸ-jѬNu{ҹfv)[Ľvwfg(ٷfe+0mYj8Q1\ݧg]Eǎvڿc!4#j5̋C2"}BRriFp7=ô\TZ:\BLfj#I22װ<;صZl j 6:l"6]۸ K'6RTѯ^ئOԓV\?$x7s#r:Oh{ց=MmuHԷd{pN /܅:UE#Yy+(SgQ(Щ)RHzw>^Ѿݻ>mK&^ '$Jۻ&w%F|xfz%˳ L~3N?Cy9 v w/{ƿ kz3x> sXv}vP"@WyC z`'톽Dw%-tt yVY\wmuPYQA0iG-2JP,6/gˢ]u.-n!Zw.N7Q]Df}Q0({a\@=i_X7gFǘ8^⻲}G MZ1)WEfO12G+=-B@z\`||w6ċj߬m}UwRox֢I &c~XGP6Qndpvܻul'V7^FJt^{b^B(L~sѣ6@߿^xqU!ڙ5|Vpvef-uӥ^3  FSDɯKD%0r}FF穛r7 +o"V8tv̖NQU!5uFd"bCr^bJ=֤fM#ʳԷP0O-9xRBm\=`r-:;~3Tl(nXtXi%2Vٛ#vwqƴ`L@"H‹qW.j,JM5B[)WܺUeZFqc'V˷1W7V̾-MHФwn8N;HPSdݷC7&2j.W\τGŎ'Vb]c.x+Rx1%C2T{myg[qU|+m:M:շ8҉yWd)ՋWS%%:iqlʹmGwݹ WnNŤѩ5(9hTٵDdGUi-)vSs2 2{OnT$Xck n:¶(lASLeȔBjμPpTb2~N2~%^k[ܗ[Jzs0ӓHBKq[}JَA-$dFQgjxxFv4r/x*Rm% `4J(&iv7SkԲmSH1YWmx 8n.k']:Z˭_W >ڃXЩ. jTq%Aā[E}amc]D:rmHRiu:uӚӢ\p(5-q%e)(۬ҖȽIf<߽pr&ݫVfY91q2ĭEQgYbTGQ&,yL+N$[q*RVۉQ=FuTܻ>f>f㋳8N6$܌n)9&»iˤsX,݅܍ȩv+sRTpO}d?Wn/Inpȸ%O]StQO|v5\}7Zwb.AIVK^:wb{[uݯcytO߶S<{8KSRׁH̏N7ۚ[xkwYy_'ZӵF+>쌛ZUĦreE9F[24De{}@:ExWs-\ǻ7K-\JNvEk%:s˙#κ].oͳ;լ7wB6nwu:$L; DkI#Wz.:Xp(˅v$Sq,wn\qIN-e<5Oe+vuYTpcojUI_ާP8 O 7&VL8z$_B-H-[uh]T{|8=qVRN-:Ij:7PUtXϷmy鉿:RIM~33ӸS2#׳GdŲ5+/Bx{(WzȨ5Y㞎#|˖+ ط.|e<o/rߔX>7s}VE.OVti׽ .5nNJO"95{#q}Ay9do]R"M6z\tnNS-D!@3N_jicWsy*5uٮRcWv/.,j}=S)j5C^> Ie =gu9ӛqjtz]۪TMoߧI!Ǧ¶m:,"[L!{qAv-o 3{"KʼnrIkfٶj2ƙ؄S`7` k6jzޞ?e5G&6uʷ2%ԒRKE*G\Npom F/V |C0.q_eenƣ<5Oh'67ɪn[SĽ{ڔjǘzs;~׌(ۂ`ܢ1ƣ` _l9Va6%UQWh~P~\F^ZHR@:ۧCJ{ôGeBh;~ۧnU J\O+n2 RҠ)ng}Kh{5+S×ܛ.1ZjG)iRȤIN 4%{oΜ/eO[Nffd ĹK?nnԼMqX'܌nZvq<ķbFnͪaQ`5 s,M_լ?-@_{w{ӺձJ}GF[%v\5[ŒGkOw/ΜM9rjË%2+rd~+󲕛C9U۳r[aJǭm|˒LAʨSCq[XMۺoubfp:t+ΤĻo ][ zt-*67kvS7D·MMCQXm;)܎n_h%]4ܙnRk!]ڵsDUF"`R, &#R_*[z*ZqFXɻ]7|۵w+'pFDەs=r./ᐚm3Hשy yD"jHCr':sA65نѮ^o1V/ f;nFr3VM)e*- s D'H݅fӧ\*޷[k<7u<-]֍Q8R h|p=WlW3s%Q %3l}@U-K6f-NϿu|ڴmWN׮[׸F*mW\%r! C78:޳vBG7ŵ.JթԚ2x)ST!řn~9 W:Wpܢ件{xf8ٳwKE ҰWxVB\qBZ 2wMb[lGSnyԚ~z9ZmያvoN2Afnݽjf>)j3 !;gOYʹK" Wftڎ+׭b*2ϻK>ۢӱeyԪXISUm[z+ugX%0lϏnvg!;t{BqPj>PyvR7Cj]O%+ݲ :qiMj6W}3vC/R=4Som]ŗ=ю, TF6U_-\6MyskwMr&Q\wjKܩyMϣUj0*}RZܷSdY3>Zjqj6TgzpA/M`/Cmл,޻feE[/+uk^Vs1W$G(JsW2ٰu*߻q*Y޵.Wi:ur5T),=0uRmho.twܖiYwrWHntvEj8qhf`Ͻpf(R&>Ki%I7$QӖm-2 ~yߗQ-앑/ x[k8nw.c㩵k}]FkbJl:{.(˩n0Hqvαp7 귎.Gupx[N`Yq'+ruU7[ү+>!xrȫoSo]OC# d^Q]\>!ƛGw^Mx"-+%vdX-:M2UR%d>%l ioSu6lsj7D P>XxHz Ukà(n^Q V>5cVtWj SEiJdznyej[lE' 3kuٌNn4JW)gB {4 j6&]' m-(ZMEz8cz>WZ6#7+[,MR-Z!4ܓtCyE|umj1ƽvƷV\;%>Q :#Le(iVz5 4ũۤUWxX ^(ҔsլB2w-V ^R+; ˂M\z+Uwr+RWY⺧~ Q*JcYSNSλUd8in=v K낫k\IRרSUaCFmϿ5̗P|u ZTԕ}>oYѲ1sfP+sQkX8Gb~6r,s>^\,mGL+7[n-E\.Fqḕcl*Jmjb5 ,m]c}NXfeVlǸJ5eˡ$4%g~N p4Y*WwW٧<8v#;qԩTut,m"#Y D\5V`\\Lȋ];LȇiS6ϝZ l>LruR\v=ǘϔDg=ԈdFZ+M{=|,[;0>RiSi4,S5}yxw&(E7&fݙ4UՕ! ~'Id)]ǽu2K-fޭ \08Vڅ쓬=Vy^^ IhyKR-B#Ըr=]mܻӾ'*Umkoy rTqT_i,/8Q^<ݤ|4ԻO(܄"'5N~#m.(Ҿ2i6Uev&I*<}҄$eNtÛzyWJubW^iBW.܅Wڮg]irO6Ve90sgv.+sV޿aޔ[p?3q*FutUo*eL\KM'EG*ZcAFfG5J 5jj=MJ3OK:k˝'NMB7m3uFҕ\-Ywg%PRqMIyZGY9|μvn߻5cWݷa^+X֥vnݘ\v7m>Fgzv"-;Ew֝}1|RjN𿊀7g#֟*GQQ|#/bo]p$>_Un9гUbn9׃ErQBU-^vDmVh'<R[fdHT]*~}3j;nvjc7s-rӳ Y8[n[1pJx kX[Jk9Mn!_Nю6x:iZ˦U |߉^Ԛ݃hYxk &U^bwKk.[jE+P(˞=9j@snCv7%c_7=xǁ<l {t'酚+1F‹l׭:ݻILruǶkL-L(K0L1&>wXB(pm;1fpnlp֓%Skidkt(U +xulo'/ڕeN r=^pZZ:Pnj8Hf"48ijY[ N[yZٻ+=  ø:3 ?^ܷ^Sr#YK[UF?CuhC b]GM')mڏsNrܗI]ljq6VB. W,UK"YX5{c >Iqā> T:n!,5l2VzCl|+I[*SrjnS6٨y+x,@>П.g+!rn9>N|W>OZT_ut Y""v7|sfި;Pclm EùN,{'fNT%U&LfH8~1v>Il}统u6P˗c(WV~H^bMU.o*oOF0N:_:6Smr_.b+|ݶYY غF,mwjv>f*>QM뭱Sd:`N{l/⎱;n-z~"Gze퇎J5S KG9!Gn;N1 ݎ h6m|S?ɂ5'WOÞ 7|7^ao @mxGmi^jϽ>01Mf0լD3-2T. VXR"ɥV Kl J O7|u?bvа;6.eߓ|[1bmRr,eRz`z 6܎-ͨku͹Fː dPhYgZUj}nvX;z=gVեTv_J }\1n7w2J?ޘγc\E 1Aޑzq;\r]]\Y&[nsNei\uURje*Qk2CSl*xJz-xٶlm+|UjUؓ`Ladqiĩ!Gd\W~fz;Tn*PdRM&T4`չSWq5k훶(N"Ӎ% V]֦wb.nUO!u*J&Oӕ2e|Z=eV쫚΅g#+/RW:طnbi*Wyo)p{:ETKؚR(RY+r웓r(IF) VmȵNB:h Q1ғ|u8E]{,'$-TR[j49l*3"I鯴zhd>Q+\BkNF=.$ZR4Nwհ(IpNi.(Gi33#33e$FXK*NdWrud[r{xnk$v2ıh+J1TQ[#JQl[tRO]LHKٮ NӍnF񨔤֞Em'MILB"ԋ%dBŋ+p̿_17jzT~4pc Vo\ƹb9Rq-'1j;8ܗ)hE%DZKS<璸Bu*%*Yw5ڻ9ۣ^z4U; Ñk\U(o~G?VUĎ:?P?_F_Kߤ~ᓾI |pr.Ok\SklRhҪz{­P .}SktZ7UQ4ڌIM8̈eaӊJZ%FFZu,KZvln廐SNFIVtuNi?CM5]+Ph,{jN JSR$IS^tSUVrORYu.9WyP6 [Kiu m!X|]Y79ӄ)\ģ)pbڳr%*&ꑶ_-H*dzk)1 V3')UAϹٶWRxe'պn۫h7AR9 EAJeGLms!%D| A 5]/Q3eb̄vnVn%za\m kZnv([emqrIҕij|""><hjJשvvǕ|Pޟs}V~2&Z?+2N&Z4w@)4iSڪ_>/JN9Hiۏuf8'It[ȲR.hZ$ȋ_Y ~U<UUO*6b)Ovzڜj\R̋.$FsQuҊj^נ䈈y<zZIuP[}Qm=C?zN(Exqu/kn S-FzKZzOסӽjJ\)F3b!r5ٝ|;6 o=-3*λ]αb\abqRi-w޵⦪~b8Kpo)Z=>)ғ"5/GTZLE-輵f7ݘ۹~+&+w/7GFI:l33fg.N~۲\2|*cnermnnM+Fq"ѪIz%j =YW8@~gc/~?N'?)«qȸs➟n=k" X“m֮VreMh2[uݖ] *FܖN)MȐ`f0 g,C9̑o;ddudJ=In13:ݒvvdMUEJLp^,6t-@͐9'{7m{-3,>hnF;ѰM)->>+Ěz!R* :`e--m7nB\u{b U>[8֪]6^ߤLʦ\DFNo$$dͶlgno8OrsQ\l̯hRo8tuNo+ CTxu!2[>ctFpeޓƻֶR"3QrQuOѳgwQr;S~)6HhZw/GgVTmUf_yt7%$];zLWF̰xy2Ʉu!MCmš_0[W6jf#a-KLi+3Q7c^qg%s<1aYIQeZf+}>;S6L0]Yu_h9߻<ƅpmiM$AVvŚ,*#t2.8Y)-Zhshü97/#Oro"u^/uFgWɺ,p:6a,^x%$Yve^3PƗMnTP&yS}OJ '덫MH^:rXԴJۋ/rI;S*,+yz1hv)Qw^ڍJ2oL׊q(\fDj:^T%vOadɂnS}ZO)N*λdaȜkG_PIEO}нa(^iQX᯦-7^)%g'SJx(.S9zVɴZ{E ))ۅi/s7 VIV-|sj0*UBTHIqRf>FP$KqN0 R̻8j\GcC}IUz\i 6F)Q{Gҧ3qSzKj-Az VЛS-zy:8*mNk|D鿓ND2u+0Yŝ7kqm·?8Ib]u>˗^_>(]vӋzv+ݩ){vZrJ2RQ몋C$z [,pp,8mڊbR]Il .f~d/ݓs㓓mͶ{mgjQwn=Oic9ܚm4Q/6ݨ[TƧ?nԶoytf{@AzT{e{[O'ZRZt~AGD?s3􌿂ՉIw'|~U\ w~di:Kޱ)U/sU%njѩ&GSP^ǝd)..!^U` 1wX[aԇSxoFV6_扐)T 2Mfd=ۖͭiZ7KK Bi9%7@<3<ճԻU,},a}FRqɛr i@ONJvK KLN M, ʖv0n-]DwlI-X6ܶ$Jʴh5O+mOI+Ra瞠\ MG7BفjYo1#͖0V`Ѱ2M?c8>-Crt*JkIGS:e#hPKx[鱼>{5m;wcն&>j-M֥^َ) 6yȜl_w{-ō̱r> U=]iw3)r*]:K]6BdCTZ|>gf}LW}[$'Y5 &c -j.z6R 67MԷFMnÌwI7w5E}o޽+K ֵy4܌ȥW"COyR[q5Ӱ͙f[v"_#q{MV6܍3"u9BK(41ӯqˇc${ߝCi6I(OmθzҜ5k^:>Jzw.>qV8{vU[ڶEm|DžBz].KHjI]x;Mɗ{m,qZXr忇2u^RO2Z}ZێS[2Jen!*NDcrBUً4<ǼMҲs1Zw57c3&ĖڻzmP*FuJG1-dN:|OU}ҵgi2t~F^^Z.VxjvŧnNNh<:]^~NN+ge^g.SԔGFe߯'[vn'(ScJ]kܗ7eJOlRrfziݮq̋S"\*U<*W]k$FջV}? 7g#֟*GQQ|#/bo]p$>_Un9;l S VvQU%OLU{οmU6bZ1MTx%!֙Q7, J=!3 ;Q,ڌ;6ͱ݅q^&ߔ·n #WbwӖX.HtG)N&d̵zpI,n cu ޖUj+VXUp[w]N o.J6Z8Ts&utxln;~HPHS/xw`G\ʡ¿rj Z^vt"[L:SD\h0sUwR,}[x^X,R2Vn< ]2YDr[SRKs8tXb̷G?Ps Tv 3be,zVz D[/I.KOEQrm'$7|[J>r S`5յwT#\w1FTz\Ԛ &"ׅhSHrD\'r]~/>p;:Piuu:"9ő=tTaS7V2rӷk7mb[^WmPp*[y.Þ6f]cizJCgRR@UVl큝.WJP1N{/\whZ ػϧӱE7|E֫Sί.x-Y&pi%v''-x6r'Ws*6=DwwUu]=C?MK [yrtܒG$!WGqJ*%SAz ED[^)/tė/g=#Omd.|^n/sl׉g DZqemqowݮRzUܜ=ڽ-o/Iۖ;qVʘgPp|mm;6zGl9.8pwWgsJ2qPbe}}UpNjٯ}7TMQKrؽtEx%v w߾8%|j;~|}pK]ơ/ w߾8%|j;~|}pK]ơ/ w&~e_H 8PL7:%ʭ5Kw&U2vwR_+rm'}C7#rWoO&HoG?M$UR7{FU]u ;# !Wk`|W>׹潇9Vn)6)*ҹ{%qV4q>W1vi#T"Qk&GwxcJBJ- Ϸ^ˁxkU}ԣ/3.;]J=<*)cS)ROK9H=,r zX @)cS)Da^ԽQ gxJI=w֣gf*TRj

*Corresponding author (rgrams@tu.ac.th)
• Received: May 4, 2021   • Revised: July 4, 2021   • Accepted: July 20, 2021

© 2021, Korean Society for Parasitology and Tropical Medicine

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (https://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 6,746 Views
  • 107 Download
  • 3 Web of Science
  • 4 Crossref
  • 4 Scopus
prev next
  • A rumen fluke Fischoederius elongatus is assigned to the type species of genus Fischoederius, family Gastrothylacidae. However, the mitochondrial sequences recently published are thought to be of inconsistent species, suggesting that several morphologically similar but genetically distinct species might be classified as Fischoederius elongatus. Thus, mentions of F. elongatus from South, Southeast, and East Asia might unintentionally refer to different species. The present work describes morphology and a full mitochondrial genome sequence of one of these species. The fluke specimens were collected from 2 infected cattle in Thailand. An interesting finding was the presence of a second tRNA-Asp gene next to a partial ND1 gene. It is suggested that these duplicated sequences are the remnants of non-reciprocal recombination events caused by inverted repeats located between ND2 and ND1 mitochondrial genes.
Amphistomes in the genus Fischoederius have been reported from cattle in Thailand [1] and other countries in Asia. A critical phase in amphistomiasis is intense acute infection when the excysted juvenile flukes give severe damage to the duodenal wall, and this again might especially affect naive calves [2]. Human infection seems to be very rare and only a single case was listed in a review on foodborne intestinal flukes from Southeast Asia [3]. One of the Fischoederius species often mentioned is Fischoederius elongatus which is used as the type-species [4,5]. It was first described as Gastrothylax elongatus in 1883 [6] and renamed to F. elongatus upon introduction of the genus Fischoederius in 1910 [7]. At that time F. cobboldi (Poirier, 1883), F. fischoederi, F. ceylonensis, and F. siamensis were also placed in this genus [7]. In 1923 the latter 3 species were synonymized under F. elongatus (Stiles and Goldberger, 1910) [8] with argument that there was no sufficient morphological difference between them. Nowadays the limited set of zoological characteristics that hampered classification in these flukes might be overcome by molecular sequence analysis. Indeed, this seems to happen right now because researchers have started to publish conflicting molecular data in the genus Fischoederius. In phylogenetic research on rumen flukes from India, partial ribosomal RNA ITS2 and mitochondrial COX1 sequences were reported from F. cobboldi and F. elongatus [9,10] without supporting morphological evidence. Shortly thereafter researchers from China published the full mitochondrial genome sequences for F. cobboldi (GenBank: NC_030529) and F. elongatus [11]. The current GenBank entry for F. cobboldi does not cite an associated publication, and the F. elongatus publication did not provide morphological evidence. The COX1 sequences from India and China are conflicting for both species. A recent publication from Thailand reported partial COX1 data purported to originate from F. elongatus [12]. Again, there are sequence differences among the data from India and China and also sequence differences among their own samples. Morphological evidence was provided but not directly linked to specific sequences because the authors might have assumed that all these sequence differences were intragenic polymorphisms and that their samples represented only 1 species.
In this study, we present linked molecular and morphological data for a single Fischoederius sp. from Thailand. This species was found to follow the classical description of F. elongatus. Its molecular data was consistent with partial COX1 data from India [10], but different from the COX1 data from China [11] and Thailand [12]. This begs the question who is the ‘real’ F. elongatus and who will reverse the synonymization of F. fischoederi, F. ceylonensis, and F. siamensis? Ultimately, these conflicts can only be resolved if molecular signatures can be obtained from the original samples described in 1883 and 1910 [6,7]. Until then it is important to avoid species designation to prevent ongoing confusion.
Collection of parasites
Parasites were collected from the rumen of 2 naturally infected cattle sacrificed at a local slaughter house (coordinates: 14.0390°N, 100.6207°E) in Pathum Thani province, Thailand on the 5th of August 2014 and the 15th of February 2016. The flukes were washed several times in 1xPBS, pH 7.4. The worms were either stored in liquid nitrogen until extraction of DNA or RNA or used for preparation of stained whole mounts and paraffin embedded tissue as described in the following sections.
Imaging of unstained parasites
Images of parasites in cattle rumen and 6-well culture dishes (Thermo Fisher Scientific, Waltham, Massachusetts, USA) were acquired with an ASUS ZenFone ZD551KL (ASUSTeK Computer Inc., Taiwan). Parasites collected in 2014 were flattened in 1×PBS, pH 7.4 between 2 microscopic slides and images were taken under a Nikon SMZ445 stereo microscope with a C-LEDS Hybrid LED Stand (Nikon Corporation, Japan) at 0.8X objective magnification using an iPhone 7 (Apple Inc., California, USA) with an iDu LabCam microscope adapter for iPhone 7/8 with multi-fit wide field 10X ocular (iDu Optics LLC, New York, USA). The COX1 sequence of these specimens was subsequently determined from extracted DNA as described below.
Preparation of stained whole mounts
PBS-washed mature and immature flukes collected in 2014 and 2016, respectively, were flattened between 2 glass slides and fixed in alcohol-formal acetic acid (AFA) fixative overnight. The fixed flukes were dehydrated in 70% ethanol for 30 min and immersed in Semichon’s carmine at room temperature, overnight. The flukes were dehydrated in 80–95% serial ethanol, 30 min each step, and counterstained with 0.02% fast green for 2–3 sec. The stained flukes were dehydrated in absolute ethanol, 30 min and cleared in xylene, 1 hr. They were mounted in Permount (Thermo Fisher Scientific) and examined under a light microscope.
Preparation of stained sections
PBS-washed immature flukes collected in 2016 were fixed in Bouin’s fixative solution (Sigma, St. Louis, Missouri, USA) at room temperature, overnight. The fixed flukes were gradually dehydrated in 50–100% ethanol with each step repeated 3 times, 20 min each step. Absolute ethanol was replaced with xylene 3 times, 10 min each. The flukes were incubated in xylene: paraplast mixed at ratios 2:1, 1:1, 1:2 at 60°C, 1 hr each step. The flukes were then incubated in pure paraplast at 60°C, 3 times, 1 hr each step. The embedded tissue was cut into 8-μm serial cross-sections and the sections were placed on gelatin coated microscopic glass slides and dewaxed and rehydrated. Basophilic substances were stained with progressive hematoxylin for 7 min. Nuclear coloration was converted from reddish purple to a crisp blue by bluing solution for 1 min. Acidophilic substances were stained with eosin for 15 sec. The stained tissue was dehydrated in graded ethanol series from 95% to 100% for each 1 min, and preserved in xylene, 10 min. The tissue was mounted in xylene based mounting medium and observed under a light microscope.
RNA extraction, NGS sequencing
Total RNA of 5 immature Fischoederius sp. 1 (Thailand) collected in 2016 was separately extracted in TRIzol reagent (AmbionTM Life Technologies, Waltham, Massachusetts, USA). The RNA was dissolved in RNase-free water and purified using a QIAgen RNeasy® Plus Mini Kit (QIAgen, Hilden, Germany) to remove contaminating DNA. RT-PCR with primer pair 15/18 (Table 1) was used to amplify a 1,536 bp COX1 fragment from each RNA sample. The PCR products were sequenced to confirm sequence identity between the samples. RNA quality was analyzed by 1.2% (w/v) denaturing agarose gel electrophoresis. The concentration of RNA was measured on a NanoDrop ND-2000 UV-Vis spectrophotometer (Thermo Fisher Scientific). RNA at an amount of 14 μg (461 ng/μl) was mixed with GenTegra-RNA matrix in a RNAstable tube (Biomatrica, San Diego, California, USA) and dried in a vacuum desiccator, 4 hr. Following drying, the pooled RNA was shipped to Vishuo Biomedical, Singapore for NGS sequencing on an Illumina HiSeq instrument. Remaining total RNA was kept at −80°C. The Bridger de novo transcriptome assembler [13] was used to assemble the raw data. Mitochondrial sequences among the transcripts were identified by NCBI BLASTN searches using the mitochondrial genomes of F. cobboldi (GenBank: NC_030529), F. elongatus (GenBank: NC_02800) as query sequences.
DNA extraction, PCR, and sequencing
The extraction of DNA from Fischoederius sp. 1 (Thailand) specimens was done as previously described [14]. The DNA was used in standard PCR for amplification of specific mitochondrial DNA fragments to either quality control transcriptome data or to add missing sequence data in the region between the ND2 and ND1 genes. The used primers and their details are listed in Table 1. PCR products were inserted into the pGEM®-T Easy vector (Promega, Wisconsin, USA) by standard ligation and had their sequences determined by Sanger dideoxy sequencing (SolGent, Daejeon, Korea and Macrogen, Daejeon, Korea).
Analysis of mitochondrial sequence data
Genes and functional RNAs in the mitochondrial genome of Fischoederius sp. 1 (Thailand) were identified by sequence comparison with the mitochondrial genomes of F. cobboldi (GenBank: NC_030529) and F. elongatus (GenBank: NC_02800). Furthermore, MITOS [15] was used for verification of mitochondrial genome annotation. All identified gene and functional RNA sequences were carefully inspected and their 5′ and 3′ ends were manually confirmed and corrected if necessary.
Pairwise nucleotide sequence alignments of all mitochondrial genes (COX3, CYTB, ND4L, ND4, ATP6, ND2, ND1, ND3, COX1, COX2, ND6, and ND5) of Fischoederius sp. 1 (Thailand), F. cobboldi (GenBank: NC_030529), F. elongatus (GenBank: NC_02800) genes were done in EMBOSS needle [16] to obtain sequence identity values (Table 2). The gapopen penalty was set to 30 to suppress invalid gaps.
The deduced amino acid sequences of all mitochondrial genes of Fischoederius sp. 1 (Thailand), F. cobboldi (GenBank: NC_030529), F. elongatus (GenBank: NC_02800), Gastrothylax crumenifer (GenBank: NC_027833), Calicophoron microbothrioides (GenBank: NC_027271), Explanatum explanatum (GenBank: NC_027958), Fasciola hepatica (GenBank: NC_002546), Homalogaster paloniae (GenBank: NC_030530), Ogmocotyle sikae (GenBank: NC_027112), Ogmocotyle sp JM 2015 (GenBank: KR006935), Orthocoelium streptocoelium (GenBank: NC_ 028071), Paramphistomum cervi (GenBank: NC_023095) were concatenated for each species and aligned in Clustal Omega [17] (Supplementary Fig. S1). Regions containing gaps were then removed in trimal [18]. Phylogenetic analysis of the alignment was performed in MrBayes 3.2.5 [19] using a Bayesian approach. The following parameters were used in the analysis: outgroup Fasciola hepatica, prset aamodelpr=mixed; mcmc nchains=4 ngen=100,000.
Partial COX1 sequences from India (GenBank: JX518952–JX518954, JX518950, JX518951, JQ806364, and JQ806365) and Thailand (GenBank: MN437486–MN437488) were aligned in Clustal Omega with the corresponding region (base pairs 703–1,065) of the COX1 gene from Fischoederius sp. 1 (Thailand), F. cobboldi (China, GenBank: NC_030529), F. elongatus (China, GenBank: NC_02800) (Supplementary Fig. S2).
Morphology of Fischoederius sp. 1
Fischoederius specimens were collected from a cow (Bos taurus indicus/Bos taurus hybrid) with a single infection spot in its rumen which suggested a single infection event. Moreover, molecular analysis of the mitochondrial COX1 gene from several worms showed the same sequence. The flukes in the rumen revealed a turgid, bottle-like appearance and reddish-brown color (Fig. 1A). The flukes were washed and kept in PBS and relaxed to a more elongated form (Fig. 1B). Microscopic examination revealed that all of the flukes were immature, i.e., the reproductive system was underdeveloped; thus eggs were absent from the flukes.
A small number of mature parasites with identical COX1 sequence was found in another cow that suffered from multiple infections. The image of an unstained specimen that was subsequently used for DNA extraction and COX1 sequencing is shown in Fig. 1C. Natural pigmentation limited the resolution of its morphology. Other Fischoederius specimens collected from this animal had significant different COX1 sequences and will be reported elsewhere. Carmine-stained mature and immature specimens were prepared to reveal the details of their morphology (Fig. 1D). Parasite morphology was found to be in general as described for F. elongatus [4,5]. In the mature parasite the lateral vitellaria fields extended from the distal end of the uterus at the genital pore down to the anterior testis. The ventral pouch opened in the area of the pharynx and extended to the posterior end of the anterior testis. The ovary was located between the lobed testes and the egg-filled sinusoid uterus progressed midline between the ceca and ended at the genital pore in the region of the cecal bifurcation. The distal end of the pair of slightly sinusoid ceca was within the anterior half of the body (Fig. 1D). The immature parasite had the same overall morphology but lacked visible vitellaria and showed only underdeveloped reproductive organs (Fig. 1D). Cross sections of an immature specimen (Fig. 2) showed further details similar to historical descriptions of F. elongatus (F. siamensis/F. fischoederi) [7]. Triangular form of the ventral pouch, location of the genital pore at the cecal bifurcation, maximum body diameter in the first third of the body, testes located at the caudal end of the ventral pouch, one anterodorsal to the other with the former located above the ventral pouch and the latter behind it.
Mitochondrial genome of Fischoederius sp. 1
The total RNA of 5 worms with confirmed identical COX1 sequence was pooled and used in a transcriptome project (BioProject PRJNA723375). Assembled transcript sequences identified by BLASTN as mitochondrial confirmed that the data originated from a single species but also showed that the mitochondrial data between the ND2 and ND1 genes was incomplete. For this reason PCR with genomic DNA was used to amplify this part of the mitochondrial genome and the ND2, ND1 genes were included to validate the transcriptome data. PCR amplification proceeded without problems but subsequent sequencing reactions failed 3′ to ND2_tRNA-Val and 5′ to tRNA-Asp_ND1. Based on PCR product sizes a region of approximate 750 bp that should include the still missing tRNA-Ala sequence could not be resolved. Forward and reverse primers designed on a published Fischoederius tRNA-Ala sequence (GenBank: NC_028001) were then used to resolve sequences from inside this region together with primers binding outside. Tedious manual interpretation of the sequencing results allowed to resolve the full sequence. The difficulties were caused by 2 large inverted repeat units that obviously formed structures interfering with DNA synthesis during sequencing. The region including the repeats had a size of 746 bp and included a second tRNA-Asp and a partial ND1 gene (117 bp of the gene’s 5′-end) followed by the expected tRNA-Ala (Fig. 3). The complete 14,780 bp mitochondrial genome of Fischoederius sp. 1 (Thailand) contained 12 protein coding genes in the order COX3, CYTB, ND4L, ND4, ATP6, ND2, ND1, ND3, COX1, COX2, ND6, ND5, 23 tRNAs in the order H, Q, F, M, V, D, A, D, N, P, I, K, S, W, T, C, Y, L, S, L, R, G, E, and one each rRNA L and rRNA S (Fig. 3). Sequence comparison of the 12 protein coding genes of Fischoederius sp. 1 (Thailand), F. elongatus (China), F. cobboldi (China) showed significant differences ranging from 6.0–13.2% (Table 2) that were far beyond intraspecies variation (nucleotide polymorphisms) and supported classification as 3 different species. A phylogenetic analysis of the 12 mitochondrial proteins between 12 trematodes confirmed the taxonomic position of Fischoederius sp. 1 (Thailand) in the Gastrothylacidae (Fig. 4). The alignment of the concatenated sequences used in this analysis had a length of 3,312 amino acids and covered 67.23% (9,936 bp) of the 14,780 bp mitochondrial genome (Supplementary Fig. S1). Partial COX1 sequence data from India referring to F. elongatus (GenBank: JX518952–JX518954, JQ806365) was found to be identical with Fischoederius sp. 1 (Thailand) whereas partial F. elongatus COX1 sequence data recently reported from Thailand (GenBank: MN437486–MN437488) was different to the here reported data and the F. elongatus COX1 data from China and India (Supplementary Fig. S2).
In this research, we have demonstrated that a Fischoederius species collected from cattle in Thailand follows the classical morphological description of F. elongatus [6,7]. Its complete mitochondrial genome sequence was determined and shown to be significantly different from those of F. elongatus [11] and F. cobboldi (GenBank: NC_030529) reported from China (Table 2; Figs. 3, 4). Moreover, partial F. elongatus COX1 sequences from Thailand [12] were different from our reported sequence and the mentioned sequences from China. Partial F. elongatus COX1 sequence data from India were consistent with our data and partial F. cobboldi COX1 sequence data from India [10] were in conflict with the F. cobboldi COX1 sequence from China (Supplementary Fig. S2). Thus, it must be assumed that there are several Fischoederius species with similar morphologies that need to be differentiated by molecular sequence data. Without molecular data from the original samples analyzed in 1883 [6] and 1910 [7] it will be difficult to assign either the correct species name or to decide that the molecular data originated from a new species. It is important to resolve these conflicting data to avoid ongoing confusion. In respect to the morphology of Fischoederius species, it is flexible and seems to be affected by crowding [20]. Thus, many parasites from different infected animals should be compared to conclude morphological flexibility.
The reported mitochondrial genome of Fischoederius sp. 1 follows in its overall organization those of the purported F. elongatus and F. cobboldi from China and the main interesting point should be the sequence duplication of tRNA-Asp and 5′ end of ND1 (Fig. 4) that were likely caused by the inverted repeats located next to them. These kinds of repeats are able to form stem loops that can lead to problems in replication and to illegitimate recombination [21]. The caused structural problems were very evident (1) in the transcriptome sequencing that lacked this region and (2) in our subsequent DNA Sanger sequencing attempts which needed to be repeated with a number of different primers from different locations until all data could be assembled.

We declare that we have no conflict of interest related to this work.

Supplementary Fig. S1.
Multiple alignment of the deduced and concatenated amino acid sequences of the 12 mitochondrial genes of the indicated trematode species.
kjp-59-4-355-suppl1.pdf
Supplementary Fig. S2.
Alignment of partial Fischoederius COX1 nucleotide sequences (363 bp) from Thailand (TH), China (CH), and India (IN), Fe: F. elongatus, Fc: F. cobboldi.
kjp-59-4-355-suppl2.pdf
This work was funded by the Thailand Research Fund through a Royal Golden Jubilee Ph.D. scholarship to Pichanee Watthanasiri (PHD/0061/2556) and Thammasat University Research Unit in Parasitic Diseases.
Nucleotide sequences of Fischoederius sp. 1 (Thailand) in this paper are deposited in GenBank under accession number MZ043126 and BioProject PRJNA723375.
Fig. 1
Morphology of Fischoederius sp. 1, Thailand. (A) Cattle rumen with an infected spot covered with a large number of flukes showing turgid bottle-like appearance. (B) Immature flukes in PBS overnight at room temperature. (C) An unstained mature fluke. The COX1 sequence was determined from this specimen after taking photo. (D) Micrographs of carmine-stained mature and immature specimens. A stippled line outlines the distal end of the ventral pouch in the immature specimen. Acetabulum (A), intestinal ceca (C), ovary (O), pharynx (P), testes (T), uterus (U), vitellaria (V) are indicated. The region of bilateral vitellaria fields is indicated by a horizontal line on top of the mature specimen.
kjp-59-4-355f1.jpg
Fig. 2
Cross sections, anterior to posterior, prepared from a single immature Fischoederius sp. 1 specimen, dorsal side up. Hematoxylin-eosin stained. (A) pharynx (P) and anterior end of triangular ventral pouch (V). (B) cecal bifurcation (Cb) and genital pore (G). (C) the 2 ceca (C) at maximum body diameter. (D) region containing the dorsoanterior testis (T) and the posterior end of the ventral pouch. (E) ventrally positioned posterior testis. (F) muscular acetabulum (A).
kjp-59-4-355f2.jpg
Fig. 3
Organization of the mitochondrial genome of Fischoederius sp. 1, Thailand. Protein coding regions are shown in yellow, functional RNA coding regions in red color. The tRNAs are indicated by the single letter code of their cognate amino acids. Two inverted repeat (IR) units are indicated in blue color. The inset shows details of the repetitive region which carries a duplication comprising repeat unit, tRNA-D, and 5′ region of ND1 gene.
kjp-59-4-355f3.jpg
Fig. 4
A phylogenetic tree drawn on a multiple alignment of the deduced amino acid sequences of the 12 mitochondrial genes of the indicated trematode species. Fasciola hepatica was employed as an outgroup. The tree was calculated in MrBayes and the posterior probability values are shown at the branch nodes.
kjp-59-4-355f4.jpg
Table 1
PCR primers used in the analysis of the mitochondrial genome of Fischoederius sp. 1 (Thailand)
Table 1
No. Start End Length Orientation Sequence
1 60 77 18 Reverse CCTAACAACTTCCATAAG
2 2,907 2,927 21 Forward TGGCGTTTTTGAGGTTATCAC
3 3,764 3,781 18 Reverse CGCAAAACCTTTCACACC
4 4,149 4,177 29 Forward GTGCGTGGTTATTTTGTTTCTTGGTTGAG
5 4,359 4,380 22 Reverse TTGAAACTAAAGCACAAACCAT
6 4,671 4,690 20 Forward GCTTCGTTAGTGGCTATGAG
7 4,774 4,793 20 Forward TATGTGGTGATGAGATGGTG
8 4,871 4,888 18 Forward GTTGTTGATGGGTAGTTG
9 4,958 4,976 19 Forward GGTTAAGTTTGTAATAGGA
10 5,708 5,732 25 Forward TGCTCTGCAAGTACGAGGTGAGTGT
11 5,708 5,732 25 Reverse ACACTCACCTCGTACTTGCAGAGCA
12 6,258 6,277 20 Reverse GACAACCAACTACGAACCTC
13 6,264 6,281 18 Reverse CCAAGACAACCAACTACG
14 6,811 6,828 18 Forward TTACTATGGTGCATGCTG
15 7,748 7,767 20 Forward GTGAGAAAGGTGGTCGTTTG
16 7,781 7,799 19 Reverse AACCAACACGCTTGTGATC
17 9,183 9,201 19 Forward ATGTTGTTGTGGCTGCTTG
18 9,267 9,289 23 Reverse TTAAAACCATCGATTAGAACCAC
19 10,321 10,339 19 Reverse GCAATCCTTTCGTACTAAC
20 12,076 12,095 20 Forward TCGAGAGAGTATCTTTGTAG
21 12,633 12,652 20 Reverse GCCAACCAAACCTACACATC
22 13,961 13,978 18 Forward GATGGTGTTGTGATGTGG
Table 2
Nucleotide sequence differences (%) of mitochondrial genes in the genus Fischoederius
Table 2
Gene Compared species
F1T/Fe F1T/Fc Fe/Fc
COX3 9.9 9.9 10.5
CYTB 7.2 8.0 8.8
ND4L 9.1 8.0 8.7
ND4 9.3 10.9 10.0
ATP6 8.1 9.7 7.4
ND2 10.6 10.4 10.3
ND1 8.6 9.0 9.0
ND3 12.3 11.2 11.5
COX1 7.1 6.9 7.5
COX2 6.5 6.2 6.0
ND6 10.4 11.9 13.2
ND5 10.7 10.8 11.1

Fe: F. elongatus (GenBank: NC_028001), Fc: F. cobboldi (GenBank: NC_ 030529), F1T: Fischoederius sp. 1 (Thailand).

  • 1. Sey O, Prasitirat P. Amphistomes (Trematoda, Amphistomida) of cattle and buffalo in Thailand. Miscnea zool hung 1994;9:11-17.
  • 2. Pfukenyi DM, Mukaratirwa S. Amphistome infections in domestic and wild ruminants in East and Southern Africa: A review. Onderstepoort J Vet Res 2018;85:1-13. https://doi.org/10.4102/ojvr.v85i1.1584
  • 3. Chai JY, Shin EH, Lee SH, Rim HJ. Foodborne intestinal flukes in Southeast Asia. Korean J Parasitol 2009;47(suppl):69-102. https://doi.org/10.3347/kjp.2009.47.S.S69
  • 4. Sey O. Fischoederius Stiles et Goldberger. 1910. In Sey O ed, CRC Handbook of the Zoology of Amphistomes. Boca Raton, Florida. CRC Press; 1991, pp 301-307.
  • 5. Jones A, Bray RA, Gibson DI. Keys to the Trematoda. 2:Wallingford, UK. CABI; 2005.
  • 6. Poirier J. Descriptions d’helminthes nouveaux du Palonia frontalis. Bull Soc philom Paris 1883;7:73-80.
  • 7. Stiles CW, Goldberger J. A study of the anatomy of Watsonius (n. g.) watsoni of man and of nineteen allied species of mammalian trematode worms of the superfamily Paramphistomoidea. Bull Hyg Lab Publ Health Mar Hosp Service US 1910;60:1-259. https://doi.org/10.5962/bhl.title.104724
  • 8. Maplestone PA. A revision of the Amphistomata of mammals. Ann Trop Med Parasitol 1923;17:113-213. https://doi.org/10.1080/00034983.1923.11684355
  • 9. Ghatani S, Shylla JA, Tandon V, Chatterjee A, Roy B. Molecular characterization of pouched amphistome parasites (Trematoda: Gastrothylacidae) using ribosomal ITS2 sequence and secondary structures. J Helminthol 2012;86:117-124. https://doi.org/10.1017/S0022149X11000125
  • 10. Ghatani S, Shylla JA, Roy B, Tandon V. Multilocus sequence evaluation for differentiating species of the trematode Family Gastrothylacidae, with a note on the utility of mitochondrial COI motifs in species identification. Gene 2014;548:277-284. https://doi.org/10.1016/j.gene.2014.07.046
  • 11. Yang X, Zhao Y, Wang L, Feng H, Tan L, Lei W, Zhao P, Hu M, Fang R. Analysis of the complete Fischoederius elongatus (Paramphistomidae, Trematoda) mitochondrial genome. Parasit Vectors 2015;8:279. https://doi.org/10.1186/s13071-015-0893-3
  • 12. Nak-On S, Chontananarth T. Rumen fluke, Fischoederius elongatus (Trematoda: Gastrothylacidae): Preliminary investigation of suitable conditions for egg hatching. Vet Parasitol 2020;282:109135. https://doi.org/10.1016/j.vetpar.2020.109135
  • 13. Chang Z, Li G, Liu J, Zhang Y, Ashby C, Liu D, Cramer CL, Huang X. Bridger: a new framework for de novo transcriptome assembly using RNA-seq data. Genome Biol 2015;16:30. https://doi.org/10.1186/s13059-015-0596-2
  • 14. Adisakwattana P, Viyanant V, Chaicumpa W, Vichasri-Grams S, Hofmann A, Korge G, Sobhon P, Grams R. Comparative molecular analysis of two asparaginyl endopeptidases and encoding genes from Fasciola gigantica. Mol Biochem Parasitol 2007;156:102-116. https://doi.org/10.1016/j.molbiopara.2007.07.006
  • 15. Bernt M, Donath A, Jühling F, Externbrink F, Florentz C, Fritzsch G, Pütz J, Middendorf M, Stadler PF. MITOS: improved de novo metazoan mitochondrial genome annotation. Mol Phylogenet Evol 2013;69:313-319. https://doi.org/10.1016/j.ympev.2012.08.023
  • 16. Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet 2000;16:276-277. https://doi.org/10.1016/S0168-9525(00)02024-2
  • 17. Sievers F, Wilm A, Dineen D, Gibson TJ, Karplus K, Li W, Lopez R, McWilliam H, Remmert M, Söding J, Thompson JD, Higgins DG. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol Syst Biol 2011;7:539. https://doi.org/10.1038/msb.2011.75
  • 18. Capella-Gutiérrez S, Silla-Martínez JM, Gabaldón T. trimAl: a tool for automated alignment trimming in large-scale phylogenetic analyses. Bioinformatics 2009;25:1972-1973. https://doi.org/10.1093/bioinformatics/btp348
  • 19. Ronquist F, Huelsenbeck JP. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 2003;19:1572-1574. https://doi.org/10.1093/bioinformatics/btg180
  • 20. Tandon RS. Studies on “crowding effect” on Gastrothylax crumenifer and Fischoederius elongatus, the common amphistome parasites of ruminants, observed under natural conditions. Res Bull Meguro Parasit Mus 1973;7:12-14.
  • 21. Lin CT, Lin WH, Lyu YL, Whang-Peng J. Inverted repeats as genetic elements for promoting DNA inverted duplication: implications in gene amplification. Nucleic Acids Res 2001;29:3529-3538. https://doi.org/10.1093/nar/29.17.3529

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Morphology and Mitochondrial Genome of Fischoederius sp. 1 in Thailand
Korean J Parasitol. 2021;59(4):355-362.   Published online August 18, 2021
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Morphology and Mitochondrial Genome of Fischoederius sp. 1 in Thailand
Korean J Parasitol. 2021;59(4):355-362.   Published online August 18, 2021
Close

Figure

  • 0
  • 1
  • 2
  • 3
Morphology and Mitochondrial Genome of Fischoederius sp. 1 in Thailand
Image Image Image Image
Fig. 1 Morphology of Fischoederius sp. 1, Thailand. (A) Cattle rumen with an infected spot covered with a large number of flukes showing turgid bottle-like appearance. (B) Immature flukes in PBS overnight at room temperature. (C) An unstained mature fluke. The COX1 sequence was determined from this specimen after taking photo. (D) Micrographs of carmine-stained mature and immature specimens. A stippled line outlines the distal end of the ventral pouch in the immature specimen. Acetabulum (A), intestinal ceca (C), ovary (O), pharynx (P), testes (T), uterus (U), vitellaria (V) are indicated. The region of bilateral vitellaria fields is indicated by a horizontal line on top of the mature specimen.
Fig. 2 Cross sections, anterior to posterior, prepared from a single immature Fischoederius sp. 1 specimen, dorsal side up. Hematoxylin-eosin stained. (A) pharynx (P) and anterior end of triangular ventral pouch (V). (B) cecal bifurcation (Cb) and genital pore (G). (C) the 2 ceca (C) at maximum body diameter. (D) region containing the dorsoanterior testis (T) and the posterior end of the ventral pouch. (E) ventrally positioned posterior testis. (F) muscular acetabulum (A).
Fig. 3 Organization of the mitochondrial genome of Fischoederius sp. 1, Thailand. Protein coding regions are shown in yellow, functional RNA coding regions in red color. The tRNAs are indicated by the single letter code of their cognate amino acids. Two inverted repeat (IR) units are indicated in blue color. The inset shows details of the repetitive region which carries a duplication comprising repeat unit, tRNA-D, and 5′ region of ND1 gene.
Fig. 4 A phylogenetic tree drawn on a multiple alignment of the deduced amino acid sequences of the 12 mitochondrial genes of the indicated trematode species. Fasciola hepatica was employed as an outgroup. The tree was calculated in MrBayes and the posterior probability values are shown at the branch nodes.
Morphology and Mitochondrial Genome of Fischoederius sp. 1 in Thailand

PCR primers used in the analysis of the mitochondrial genome of Fischoederius sp. 1 (Thailand)

No. Start End Length Orientation Sequence
1 60 77 18 Reverse CCTAACAACTTCCATAAG
2 2,907 2,927 21 Forward TGGCGTTTTTGAGGTTATCAC
3 3,764 3,781 18 Reverse CGCAAAACCTTTCACACC
4 4,149 4,177 29 Forward GTGCGTGGTTATTTTGTTTCTTGGTTGAG
5 4,359 4,380 22 Reverse TTGAAACTAAAGCACAAACCAT
6 4,671 4,690 20 Forward GCTTCGTTAGTGGCTATGAG
7 4,774 4,793 20 Forward TATGTGGTGATGAGATGGTG
8 4,871 4,888 18 Forward GTTGTTGATGGGTAGTTG
9 4,958 4,976 19 Forward GGTTAAGTTTGTAATAGGA
10 5,708 5,732 25 Forward TGCTCTGCAAGTACGAGGTGAGTGT
11 5,708 5,732 25 Reverse ACACTCACCTCGTACTTGCAGAGCA
12 6,258 6,277 20 Reverse GACAACCAACTACGAACCTC
13 6,264 6,281 18 Reverse CCAAGACAACCAACTACG
14 6,811 6,828 18 Forward TTACTATGGTGCATGCTG
15 7,748 7,767 20 Forward GTGAGAAAGGTGGTCGTTTG
16 7,781 7,799 19 Reverse AACCAACACGCTTGTGATC
17 9,183 9,201 19 Forward ATGTTGTTGTGGCTGCTTG
18 9,267 9,289 23 Reverse TTAAAACCATCGATTAGAACCAC
19 10,321 10,339 19 Reverse GCAATCCTTTCGTACTAAC
20 12,076 12,095 20 Forward TCGAGAGAGTATCTTTGTAG
21 12,633 12,652 20 Reverse GCCAACCAAACCTACACATC
22 13,961 13,978 18 Forward GATGGTGTTGTGATGTGG

Nucleotide sequence differences (%) of mitochondrial genes in the genus Fischoederius

Gene Compared species
F1T/Fe F1T/Fc Fe/Fc
COX3 9.9 9.9 10.5
CYTB 7.2 8.0 8.8
ND4L 9.1 8.0 8.7
ND4 9.3 10.9 10.0
ATP6 8.1 9.7 7.4
ND2 10.6 10.4 10.3
ND1 8.6 9.0 9.0
ND3 12.3 11.2 11.5
COX1 7.1 6.9 7.5
COX2 6.5 6.2 6.0
ND6 10.4 11.9 13.2
ND5 10.7 10.8 11.1

Fe: F. elongatus (GenBank: NC_028001), Fc: F. cobboldi (GenBank: NC_ 030529), F1T: Fischoederius sp. 1 (Thailand).

Table 1 PCR primers used in the analysis of the mitochondrial genome of Fischoederius sp. 1 (Thailand)
Table 2 Nucleotide sequence differences (%) of mitochondrial genes in the genus Fischoederius

Fe: F. elongatus (GenBank: NC_028001), Fc: F. cobboldi (GenBank: NC_ 030529), F1T: Fischoederius sp. 1 (Thailand).