Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
Search
Advanced Search
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Page Path

Brief Communication

Neutrophil reactive oxygen species response to Trichomonas vaginalis modulated by palmitic acid

Julieta Sepúlveda-Angulo1orcid, Luis Mario Olmos-Ortiz2orcid, Bernardo Franco-Bárcenas1orcid, Eva E. Avila1orcid, Patricia Cuéllar-Mata1,*orcid

Published online: April 10, 2026

1Department of Biology, Division of Natural and Exact Sciences, Guanajuato Campus, Universidad de Guanajuato, Guanajuato, Mexico

2Department of Chemical, Electronic and Biomedical Engineering, Division of Sciences and Engineering, Universidad de Guanajuato, Guanajuato, Mexico

*Correspondence: mata@ugto.mx

Citation Sepúlveda-Angulo J, Olmos-Ortiz LM, Franco-Bárcenas B, Avila EE, Cuéllar-Mata P. Neutrophil reactive oxygen species response to Trichomonas vaginalis modulated by palmitic acid. Parasites Hosts Dis [Epub ahead of print].

• Received: December 2, 2025   • Accepted: December 4, 2025

© 2026, Korean Society for Parasitology and Tropical Medicine

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 30 Views
  • 2 Download

Full Article

Download PDF Download PDF
  • This study aimed to investigate the role of palmitic acid (PA) in modulating the neutrophil response during Trichomonas vaginalis infection. A human neutrophil-like cell model (nHL-60) was established by differentiating the human promyelocytic leukemia cell line HL-60 with 1.3% dimethyl sulfoxide. The expressions of the genes IL-8, NF-κB, MyD88, and TLR4 and the production of reactive oxygen species (ROS) of differentiated cells were compared, using end-point RT-PCR and nitroblue tetrazolium reduction, in the presence or absence of 1 mM PA and 100 μM of docosahexaenoic acid. Additionally, oxidative burst activity was also evaluated in response to T. vaginalis stimulation in the presence of either PA or docosahexaenoic acid. nHL-60 cells showed increased expression of key mediators of the TLR4 signaling pathway, and enhanced ROS production upon phorbol 12-myristate 13-acetate stimulation. Peripheral blood neutrophils exposed to T. vaginalis in the presence of PA exhibited higher ROS production than neutrophils stimulated by the parasite only. These findings indicate that PA enhances neutrophil activation to a secondary stimulus with T. vaginalis. They provide new insights into the role of metabolic factors in host-pathogen interactions.
  • Key words: Neutrophils, palmitic acid, Trichomonas vaginalis, reactive oxygen species, Toll-like receptor 4
Fatty acids are crucial modulators of immune responses, particularly saturated fatty acids, which often induce pro-inflammatory and immunomodulatory effects. Palmitic acid (PA), the most abundant saturated fatty acid in human plasma, has been shown to activate immune cells by inducing cytokine production, reactive oxygen species (ROS) generation, and cell migration [1]. PA induces immune activation through the Toll-like receptor 4 (TLR4) signaling cascade, triggering inflammatory responses in macrophages and other immune cells [2,3]. These effects contribute to both protective and pathological immune functions depending on the activation context [4,5].
Neutrophils are vital components of the innate immune system, acting as the first line of defense against invading pathogens. They contribute to eliminate microorganisms through mechanisms such as phagocytosis, degranulation, and the release of ROS [6]. Pattern recognition receptors, including TLR4, tightly regulate neutrophil activation by binding microbial and non-microbial components, initiating several inflammatory pathways [7]. PA mediates macrophage activation through TLR4 [8]. However, its effects on human neutrophils have remained underexplored with conflicting reports regarding its role in ROS production and inflammatory signaling [9,10]. Evidence suggests that PA can modulate neutrophil function by enhancing their migration and activation [1], yet excessive or dysregulated exposure to PA may lead to aberrant signaling through TLR4, highlighting the need for further studies to clarify the mechanisms involved.
Trichomoniasis is a widespread sexually transmitted infection caused by the parasite Trichomonas vaginalis. This infection correlates with increased susceptibility to human immunodeficiency virus, infertility, and cervical cancer [11,12]. T. vaginalis triggers a robust inflammatory response, leading to the infiltration of neutrophils into the vaginal mucosa. Neutrophils contribute to parasite elimination by releasing ROS, cytokines, IL-8, and other chemokines that regulate immune cell recruitment and the inflammatory response [13].
It is unknown if PA directly modulates neutrophil activity during trichomoniasis and whether this interaction has beneficial or detrimental consequences for pathogen elimination. To address this gap, we investigated the role of PA in modulating human neutrophil responses to T. vaginalis infection.
The human promyelocytic leukemia cell line HL-60 (American Type Culture Collection, CCL-240) was cultured in Dulbecco's modified eagle medium and differentiated into a neutrophil-like phenotype (nHL-60) by incubation with 1.3% dimethyl sulfoxide (DMSO) for 6 days. The morphological and functional characteristics of nHL-60 were compared to those of peripheral blood neutrophils isolated from healthy donors by density gradient centrifugation using Histopaque; no RBC lysis was performed. The production of ROS, was measured by incubating cells with 1 mg/mL nitroblue tetrazolium (NBT) at 37°C for 30 min, using the cells with 500 nM phorbol 12-myristate 13-acetate (PMA) as a positive control. The resulting formazan crystals were analyzed using optical microscopy, dissolved in 2 M KOH y DMSO and quantified spectrophotometrically at 620 nm. Additionally, cells were incubated with 100 ng/ml lipopolysaccharide (LPS) for 4 h, followed by total RNA extraction using Trizol and complementary DNA synthesis via end-point RT-PCR (SuperScript III kit, Invitrogen) to investigate the expression of various genes including IL-8, NF-κB, MyD88, and TLR4. The oligonucleotides used are described in Table 1 with actin as the housekeeping gene.
The evaluation of formazan formation through NBT reduction revealed the presence of formazan deposits in nHL-60 cells in the presence of PMA, whereas undifferentiated HL-60 cells did not exhibit such formations. Both peripheral blood neutrophils and HL-60 cells showed a 0.5-fold increase in IL-8 and IL-1β gene expression upon 100 ng/ml LPS stimulation (Supplementary Fig. S1). These findings confirm that 1.3% DMSO induces functional changes in HL-60 cells, resulting in a neutrophil-like model (nHL-60) that serves as a valuable tool for investigating immune response mechanisms in human cells.
We then tested the impact of stimulation with 1 mM PA or 100 μM docosahexaenoic acid (DHA) for 4 h on the expression of IL-8, NF-κB, MyD88, and TLR4 was evaluated in nHL-60 cells, with 100 ng/ml LPS serving as a positive control of cell stimulation. Additionally, superoxide anion production was analyzed by incubating cells with 1 mg/ml NBT for 30 min, using 500 nM PMA as a positive control.
Gene expression in differentiated nHL-60 cells was assessed by band intensity following end-point RT-PCR. Pre-treatment with 1 mM PA resulted in increased relative expression levels of TLR4 (0.68), MyD88 (0.17), IL-8 (0.29), and NF-κB (0.42) compared to control, indicating upregulation of key components of the TLR4 signaling pathway. In contrast, treatment with 100 µM DHA, an unsaturated fatty acid, led to markedly reduced expression levels of TLR4 (0.02), MyD88 (0.22), IL-8 (0.09), and NF-κB, suggesting a suppressive effect on the pathway (Fig. 1). Pre-treatment of nHL-60 cells for 30 min with fatty acids followed by PMA stimulation resulted in a significant increase in formazan absorbance after NBT reduction in the presence of PA, but not DHA. No such increase was observed in cells incubated solely with fatty acids, indicating that PA acts as an inducer of ROS in nHL-60 cells with a second stimulus (Fig. 2). The presence of 1 mM of PA enhanced the ROS production in human neutrophils (100,000 cells) in response to T. vaginalis GT13 (10,000 trophozoites) compared with the 500 nM PMA positive control, while DHA had no effect. These findings suggest that PA can modulate the oxidative response of human neutrophils against T. vaginalis, potentially affecting the efficiency of pathogen elimination (Fig. 3). The activation of the NADPH oxidase complex depends on the phosphorylation of its components, which can be mediated by protein kinase C, promoting the translocation of enzyme subunits from the cytosol to the membrane. Both palmitic and stearic acids have been reported to activate NADPH oxidase in hepatocellular carcinoma cells [14], and PA has been shown to do so through a protein kinase C–dependent pathway in aortic and endothelial cells [3,15]. These findings suggest the idea that PA induces ROS production in neutrophils.
Our results showing PA-induced ROS production are consistent with observations in other phagocytic cells, such as dendritic cells and macrophages [16,17]. Stearic acid—another abundant saturated fatty acid in plasma (~0.5 mM)—has also been reported to stimulate ROS production in human neutrophils at concentrations like those used for PA in this study [10].
In the present work, PA triggered a stronger ROS response than T. vaginalis, reinforcing the notion that saturated fatty acids can act as potent pro-oxidative stimuli. This agrees with previous evidence that palmitate activates TLR4–NOX2 signaling in macrophages, eliciting an oxidative burst comparable or superior to that induced by microbial ligands [17].
Interestingly, although PA alone strongly induced ROS, co-incubation with T. vaginalis suggested that the parasite may deploy protective mechanisms to limit oxidative damage (Fig. 3B), as described for Coxiella burnetii, Helicobacter pylori, and Francisella tularensis [18]. These results suggest that T. vaginalis could possess detoxification or ROS repair strategies to persist in the host environment.
To our knowledge, this is the first study to demonstrate the effects of PA on ROS production during T. vaginalis–neutrophil interactions. Since both PA and the parasite induced ROS generation, they may converge on NADPH oxidase activation through TLR4 [19], a receptor implicated in neutrophil oxidative responses. Nevertheless, alternative pathways could also be involved, as neutrophils may recognize PA and T. vaginalis through distinct G protein-coupled receptors [20].
Finally, high concentrations of neutrophil-recruiting mediators, including leukotrienes, monocyte chemoattractant proteins, and IL-8, have been detected in vaginal secretions. Since PA activates neutrophils, it would be relevant to evaluate whether PA stimulation enhances neutrophil migration and cytokine expression during T. vaginalis infection, better mimicking in vivo conditions.
In summary, our findings indicate that PA activates neutrophils and enhances ROS production in the context of T. vaginalis. These results have important implications for understanding how dietary fatty acids may modulate early innate responses against this parasite.

Author contributions

Conceptualization: Avila EE, Cuéllar-Mata P. Data curation: Sepúlveda-Angulo J. Formal analysis: Sepúlveda-Angulo J. Investigation: Sepúlveda-Angulo J. Methodology: Avila EE, Cuéllar-Mata P. Project administration: Avila EE, Cuéllar-Mata P. Resources: Olmos-Ortiz LM. Validation: Franco-Bárcenas B. Writing – original draft: Sepúlveda-Angulo J. Writing – review & editing: Franco-Bárcenas B, Avila EE, Cuéllar-Mata P.

Conflict of interest

The authors have no conflicts of interest to declare.

Acknowledgments

We thank Dr. Marion Brunck, UNAM, Mexico for their helpful discussions and suggestions. We also thank Dr Felipe Padilla-Vaca and Dr. Fernando Anaya-Velazquez for their kind donation of T. vaginalis GT21 strain. We are grateful to SICIHTI (before Consejo Nacional de Ciencia y Tecnología, Mexico) for a scholarship provided to JSA.

Supplementary material is available with this article at https://doi.org/10.3347/PHD.25089.
PHD-25089-Supplementary-Fig-S1.docx
Fig. 1.
RT-PCR analysis of gene expression in nHL-60 cells stimulated with fatty acids. (A) nHL-60 cells were left unstimulated (Control) or treated with 100 ng/ml lipopolysaccharide (LPS), 1 mM palmitic acid (PA), or 100 µM docosahexaenoic acid (DHA) for 4 h. RNA was then extracted, and RT-PCR was performed. (B) Gene expression was normalized using actin as a housekeeping gene. Data represent mean±SD from 3 independent experiments (n=3). M, DNA size marker.
PHD-25089f1.jpg
Fig. 2.
Evaluation of reactive oxygen species generation via nitroblue tetrazolium reduction in nHL-60 cells treated with fatty acids. nHL-60 cells were incubated for 30 min with 1 mg/ml nitroblue tetrazolium in the presence or absence of 500 nM 12-myristate 13-acetate, 1 mM palmitic acid (PA), or 100 µM docosahexaenoic acid (DHA). Data represent mean±SD from 2 independent experiments (n=2), each performed in technical triplicate. DMEM, Dulbecco's modified eagle medium; HAS, human serum albumin.
PHD-25089f2.jpg
Fig. 3.
Production of reactive oxygen species in neutrophils incubated with palmitic acid (PA) or docosahexaenoic acid (DHA) in the presence of Trichomonas vaginalis. Peripheral blood neutrophils (100,000) were isolated and incubated for 30 min with 1 mM PA or 100 µM DHA in the presence or absence of 10,000 trophozoites. Negative controls (unstimulated neutrophils) and positive controls (neutrophils stimulated with 500 nM 12-myristate 13-acetate) were included. Samples were analysed by (A) optical microscopy to detect formazan deposits and (B) quantification of reduced nitroblue tetrazolium as an indirect measure of formazan formation. Data represent mean±SD from 3 independent experiments (n=3), each performed in technical duplicate. Statistical analysis was performed using Kruskal-Wallis test with Dunn’s post hoc test. *P<0.05, **P<0.01.
PHD-25089f3.jpg
Table 1.
Primer sequences used for RT-PCR amplification
Table 1.
Gene Forward primer Reverse primer Amplicon size of cDNA (bp)
Actin TGAGATTGGCATGGCTTTATTTGT TGTCACCTTCACCGTCCAGTTT 101
IL-1β CTGATGGCCCTAAACAGATGAAG GGTCGGAGATTCGTAGCAGCTGG 87
TLR4 TGGATACGTTTCCTTATAAG GAAATGGAGGCACCCCTTC 507
MyD88 GGCATATGCCTGAGCGTTCGA GGGGTTGGTGTAGTCGCAGACAGT 398
NF-kB AAGTTCCTATAGAAGAGCAGCAGCGTGG TAGGAAGATCTCATCCCCACCGA 218
IL-8 TTGGCAGCCTTCCTGATTTC AACTTCTCCACAACCCTCTGCA 248

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Neutrophil reactive oxygen species response to Trichomonas vaginalis modulated by palmitic acid
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.
Format:
Include:
Neutrophil reactive oxygen species response to Trichomonas vaginalis modulated by palmitic acid
Close

Figure

  • 0
  • 1
  • 2
Neutrophil reactive oxygen species response to Trichomonas vaginalis modulated by palmitic acid
Image Image Image
Fig. 1. RT-PCR analysis of gene expression in nHL-60 cells stimulated with fatty acids. (A) nHL-60 cells were left unstimulated (Control) or treated with 100 ng/ml lipopolysaccharide (LPS), 1 mM palmitic acid (PA), or 100 µM docosahexaenoic acid (DHA) for 4 h. RNA was then extracted, and RT-PCR was performed. (B) Gene expression was normalized using actin as a housekeeping gene. Data represent mean±SD from 3 independent experiments (n=3). M, DNA size marker.
Fig. 2. Evaluation of reactive oxygen species generation via nitroblue tetrazolium reduction in nHL-60 cells treated with fatty acids. nHL-60 cells were incubated for 30 min with 1 mg/ml nitroblue tetrazolium in the presence or absence of 500 nM 12-myristate 13-acetate, 1 mM palmitic acid (PA), or 100 µM docosahexaenoic acid (DHA). Data represent mean±SD from 2 independent experiments (n=2), each performed in technical triplicate. DMEM, Dulbecco's modified eagle medium; HAS, human serum albumin.
Fig. 3. Production of reactive oxygen species in neutrophils incubated with palmitic acid (PA) or docosahexaenoic acid (DHA) in the presence of Trichomonas vaginalis. Peripheral blood neutrophils (100,000) were isolated and incubated for 30 min with 1 mM PA or 100 µM DHA in the presence or absence of 10,000 trophozoites. Negative controls (unstimulated neutrophils) and positive controls (neutrophils stimulated with 500 nM 12-myristate 13-acetate) were included. Samples were analysed by (A) optical microscopy to detect formazan deposits and (B) quantification of reduced nitroblue tetrazolium as an indirect measure of formazan formation. Data represent mean±SD from 3 independent experiments (n=3), each performed in technical duplicate. Statistical analysis was performed using Kruskal-Wallis test with Dunn’s post hoc test. *P<0.05, **P<0.01.

Fig. 1.

Fig. 2.

Fig. 3.

Neutrophil reactive oxygen species response to Trichomonas vaginalis modulated by palmitic acid
Gene Forward primer Reverse primer Amplicon size of cDNA (bp)
Actin TGAGATTGGCATGGCTTTATTTGT TGTCACCTTCACCGTCCAGTTT 101
IL-1β CTGATGGCCCTAAACAGATGAAG GGTCGGAGATTCGTAGCAGCTGG 87
TLR4 TGGATACGTTTCCTTATAAG GAAATGGAGGCACCCCTTC 507
MyD88 GGCATATGCCTGAGCGTTCGA GGGGTTGGTGTAGTCGCAGACAGT 398
NF-kB AAGTTCCTATAGAAGAGCAGCAGCGTGG TAGGAAGATCTCATCCCCACCGA 218
IL-8 TTGGCAGCCTTCCTGATTTC AACTTCTCCACAACCCTCTGCA 248
Table 1. Primer sequences used for RT-PCR amplification

Table 1.

PHD : Parasites, Hosts and Diseases

ABOUT

BROWSE ARTICLES

EDITORIAL POLICIES

FOR CONTRIBUTORS

© The Korean Society for Parasitology and Tropical Medicine.