Skip to main navigation Skip to main content
  • KSPTM
  • E-Submission

PHD : Parasites, Hosts and Diseases

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR CONTRIBUTORS

Articles

Original Article

Molecular Prevalence of Acarapis Mite Infestations in Honey Bees in Korea

The Korean Journal of Parasitology 2015;53(3):315-320.
Published online: June 30, 2015

1Department of Parasitology, College of Veterinary Medicine, Chonnam National University, Gwangju 500-757, Korea

2Animal and Plant Quarantine Agency (QIA), Anyang 430-757, Korea

3Department of Clinical Pathology, College of Veterinary Medicine, Chonnam National University, Gwangju 500-757, Korea

*Corresponding author (sungshik@jnu.ac.kr)

Sequence data from this article have been deposited with the DDBJ Data Libraries under accession nos. LC 006083-5.

• Received: January 4, 2015   • Revised: May 6, 2015   • Accepted: May 30, 2015

© 2015, Korean Society for Parasitology and Tropical Medicine

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 11,665 Views
  • 158 Download
  • 7 Web of Science
  • 7 Crossref
  • 8 Scopus
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Factors Contributing to Colony Collapse Disorder (CCD) in Iranian Honey Bee Colonies
    Sedigheh Nabian, Soheila Akhzari, Meysam Jafari, Mohammad Javad Gharagozlo, Arash Ghalyanchi Langeroudi
    Journal of Entomology.2025; 22(1): 27.     CrossRef
  • Molecular Identification and Prevalence of the Mite Carpoglyphus lactis (Acarina: Carpoglyphidae) in Apis mellifera in the Republic of Korea
    Thi-Thu Nguyen, Mi-Sun Yoo, Hyang-Sim Lee, So-Youn Youn, Se-Ji Lee, Su-Kyoung Seo, Jaemyung Kim, Yun-Sang Cho
    Insects.2024; 15(4): 271.     CrossRef
  • PCR-based detection of the honeybee tracheal mite (Acarapis woodi) in Türkiye
    Rahşan Koç Akpınar, Ali Sevim, Elif Sevim, Selma Kaya, Şakir Önder Türlek, Coşkun AYDIN, Şengül Alpay Karaoğlu, Sema Nur Çelik, Arif Bozdeveci, Gökhan Güven, Bilal Küçükoğlu, Murat Yaldız, İsmail Aydın
    Parasitology Research.2023; 122(7): 1663.     CrossRef
  • Molecular Detection and Differentiation of Arthropod, Fungal, Protozoan, Bacterial and Viral Pathogens of Honeybees
    Lucas Lannutti, Fernanda Noemi Gonzales, Maria José Dus Santos, Mónica Florin-Christensen, Leonhard Schnittger
    Veterinary Sciences.2022; 9(5): 221.     CrossRef
  • Assessment of Parasites Associated with Honeybees (Apis mellifera) from Apiaries in Ogun State, Southwestern Nigeria
    A.R. Salau, O.N. Adekunle, O.A. Lawal
    African Entomology.2020; 28(1): 19.     CrossRef
  • Honey as a Source of Environmental DNA for the Detection and Monitoring of Honey Bee Pathogens and Parasites
    Anisa Ribani, Valerio Joe Utzeri, Valeria Taurisano, Luca Fontanesi
    Veterinary Sciences.2020; 7(3): 113.     CrossRef
  • Characterisation of the British honey bee metagenome
    Tim Regan, Mark W. Barnett, Dominik R. Laetsch, Stephen J. Bush, David Wragg, Giles E. Budge, Fiona Highet, Benjamin Dainat, Joachim R. de Miranda, Mick Watson, Mark Blaxter, Tom C. Freeman
    Nature Communications.2018;[Epub]     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Molecular Prevalence of Acarapis Mite Infestations in Honey Bees in Korea
Korean J Parasitol. 2015;53(3):315-320.   Published online June 30, 2015
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Molecular Prevalence of Acarapis Mite Infestations in Honey Bees in Korea
Korean J Parasitol. 2015;53(3):315-320.   Published online June 30, 2015
Close

Figure

  • 0
  • 1
  • 2
Molecular Prevalence of Acarapis Mite Infestations in Honey Bees in Korea
Image Image Image
Fig. 1. Distribution of apiaries visited during the survey. aC indicates the number of collected colonies and bA is the number of visited apiaries in each province.
Fig. 2. Phylogenetic tree of the nucleotide of mitochondrial cytochrome c oxidase subunit I (COI) DNA fragments from Korean isolates of Acarapis mites and other refer ences of Acarapis mites.
Fig. 3. Light microscopic view of a bee trachea. (A) Clean trachea from healthy bee. (B) Trachea from Acarapis woodi positive bee by sequence analysis. Foreign bodies which assumed the mite and some debris were discovered (arrow).
Molecular Prevalence of Acarapis Mite Infestations in Honey Bees in Korea
Name for primer sets Sequence (5’ to 3’)a Length (bp) References
Kojima (K)b F- CAGTAGGGCTAGATATCGATACCCGAGCTT 247 Kojima et al. [5]
R- TGAGCTACAACATAATATCTGTCATGAAGA
Acarapis (A)c F- CGGGCCCGAGCTTATTTTACTGCTG 162 Garrido-Bailón et al. [9]
R- GCGCCTGTCAATCCACCTACAGAAA
AmHsTRPA (T)d F– CACGACATTCAAGGTTTAAGAAATCACG 426 Kojima et al. [5]
R- TCAGTTATTCTTTTCCTTTGCCAGATTT
Province No. of tested colonies Number of positive colonies (%)a
A primer set K primer set A and K primer sets Total
Gangwon 12 3 (25.0) 0 (0) 0 (0) 3 (25.0)
Gyeonggi 21 1 (4.8) 1 (4.8) 0 (0) 2 (9.5)
Chungcheong 24 5 (20.8) 0 (0) 1 (4.2) 6 (25.0)
Gyeongsang 22 19 (86.4) 1 (4.5) 1 (4.5) 21 (95.5)
Jeonla 20 8 (40.0) 0 (0) 2 (10.0) 10 (50.0)
Total 99 36 (36.4) 2 (2.0) 4 (4.0) 42 (42.4)
Species Nucleotide sequence identity (%)
Country A. dorsalis
A. dorsalis
A. dorsalis
A. externus
A. externus
A.externus
A. woodi
A. woodi
A. woodi
A. woodi
A. dorsalis
A. externus
Accession# New Zealand Canada New Zealand New Zealand New Zealand United Kingdom Canada United Kingdom USA Korea Korea Korea

HQ243439

GQ916567

HQ243434

HQ243441

HQ243440

FJ603293

GQ916565

FJ603296

EU190886

LC006084

LC006085

LC006083
A. dorsalis New Zealand HQ243439 100
A. dorsalis Canada GQ916567 99.3 100
A. dorsalis New Zealand HQ243434 100 99.3 100
A. externus New Zealand HQ243441 93.2 93.8 93.2 100
A. externus New Zealand HQ243440 93.2 93.8 93.2 100 100
A. externus United Kingdom FJ603293 93.2 93.8 93.2 100 100 100
A. woodi Canada GQ916565 96.3 95.7 96.3 94.4 94.4 94.4 100
A. woodi United Kingdom FJ603296 96.3 95.7 96.3 94.4 94.4 94.4 100 100
A. woodi USA EU190886 96.3 95.7 96.3 94.4 94.4 94.4 100 100 100
A. woodi Korea LC006084 96.9 96.3 96.9 93.8 93.8 93.8 99.3 99.3 99.3 100
A. dorsalis Korea LC006085 99.3 98.7 99.3 92.6 92.6 92.6 96.9 96.9 96.9 97.5 100
A. externus Korea LC006083 92.6 93.2 92.6 99.3 99.3 99.3 95 95 95 94.4 93.2 100
Province No. of tested colonies No. of positive colonies (%a)
A. dorsalis A. externus A. woodi Total
Gangwon 12 2 (16.7) 1 (8.4) 0 (0) 3 (25.0)
Gyeonggi 21 2 (9.5) 0 (0) 0 (0) 2 (9.5)
Chungcheong 24 6 (25.0) 0 (0) 0 (0) 6 (25.0)
Gyeongsang 22 14 (63.6) 6 (27.3) 1 (4.5) 21 (86.3)
Jeonla 20 8 (40.0) 2 (10.0) 0 (0) 10 (50.0)
Total 99 32 (32.3) 9 (9.1) 1 (1.0) 42 (42.4)
Table 1. Primer sets for Acarapis mite detection

F: forward primer; R: reverse primer.

Kojima (K); the primer set which amplifies mitochondrial cytochrome c oxidase subunit I (COI) DNA fragments of Acarapis mites.

Acarapis (A); the primer set which amplifies COI DNA fragments of Acarapis mites.

AmHsTRPA (T); the primer set which amplifies a honey bee genomic DNA fragment encoding a part of AmHsTRPA.

Table 2. PCR assay result for the bee colonies

(%)=(no. of positive colonies / no. of tested colonies with PCR assay)×100.

Table 3. Sequence relationships of the nucleotide of mitochondrial cytochrome c oxidase subunit I (COI) DNA fragments from Korean isolates of Acarapis mites
Table 4. Regional occurrence of Acarapis spp. in Apis mellifera from Korea

(%)=(no. of positive colonies / no. of tested colonies with PCR assay)×100.