The protoscoleces of hydatid cysts were obtained from the livers of naturally infected sheep slaughtered at Kerman abattoir, southeast of Iran. The hydatid fluid was aspirated aseptically using a 50 ml syringe, and then the germinal layer was removed. The layer was washed 4 times and stored at −80°C until testing. Subsequently, the collected protoscoleces were washed 4 times with sterile PBS. The number of protoscoleces per ml was adjusted as 1×10⁴ protoscoleces in 0.9% NaCl solution with more than 90% viability rate. The viability of the protoscoleces was confirmed by their flame cell motility and impermeability to 0.1% eosin solution under a light microscope. Afterwards, the parasite was genotyped as described elsewhere [4,13–15]. The protoscoleces were digested in 1% (w/v) pepsin prepared in 0.85% (w/v) NaCl (pH 4.0) for 30 min at 37°C to release protoscoleces from the brood capsules. Lastly, pepsin-digested protoscoleces were used for 3 assays; (i) in vitro culture in diphasic media to reach adult form, (ii) in vitro culture with feeder cells for microcyst formation, and (iii) in vivo adult worm formation by experimental infection of a dog.

In vitro cultivation of protoscoleces into E. granulosus adult worm in diphasic medium was carried out as described by Smyth et al. [16] with some modifications. The culture medium was S.10E.H, which consisted of 2 phases: (1) liquid phase containing 260 ml CMRL 1066 medium (Thermo Fisher Scientific, San Jose, California, USA), 100 ml heat inactivated fetal calf serum (FCS; Gibco-BRL, Gaithersburg, Maryland, USA), 36 ml 5% yeast extract (Sigma-Aldrich, St. Louis, Missouri, USA) in CMRL 1066, 5.6 ml 30% glucose (Sigma-Aldrich) in distilled water, 1.4 ml 5% dog bile in PBS, 20 mM HEPES (Sigma-Aldrich), 10 mM NaHCO₃ (Sigma-Aldrich) supplemented with penicillin (100 IU/ml), streptomycin (100 mg/ml) (Sigma-Aldrich), and (2) bovine serum coagulated at 76°C for 20–30 min as a solid phase [4,5,17]. Different stages in culture medium were isolated based on the morphological classification described by Smyth et al. [16]. The isolated stages were stored in RNAlater (QIAGEN GmbH, Hilden, Germany) at −80°C until RNA extraction.

To reach E. granulosus microcysts, protoscoleces were washed 3 times in Hanks Balanced Salt Solution (HBSS) and added to Dulbecco’s minimal essential medium (DMEM) (Thermo Fisher Scientific) containing 2 mM glutamine (Sigma-Aldrich), penicillin (100 IU/ml), and streptomycin (100 mg/ml) supplemented with 10% heat inactivated FCS. For feeding the protoscoleces during subsequent passages, 1×10⁶ Hepa 1–6 (ATCC® CRL-1830™) was added to each 200 ml flask. The flasks containing the protoscoleces were placed in an upright position in an incubator at 37°C with 5% CO₂, and the medium was changed every 4 to 8 days [13,18].

This study was conducted with approval from the Research Ethical Review Committee of Kerman University of Medical Sciences (permit no. 92/274). To establish the experimental infection in a dog, a healthy male mixed-breed dog (6 months old) was obtained from a supplier in Kerman city, Kerman Province, Iran. The animal was treated with praziquantel (10 mg/kg body weight) prior to the study commencement and kept in an individual cage to adapt to the living condition and diet. The dog was fed commercial dog food and water ad libitum. After anthelmintic treatment and subsequent microscopic stool examination verifying the negative coprological findings, the dog received approximately 10,000 viable protoscoleces of E. granulosus orally with a meal, and all subsequent food (administration once daily) was previously heat inactivated [19,20].

The dog was euthanized by intravenous barbiturate overdose (Thiopental Nesdonal® Biochemie GmbH, Vienna, Austria) 45 days after the infection and necropsied to isolate E. granulosus adult worms. The small intestine of the dog was opened longitudinally, and the sections were immersed in warm saline. Detached worms and intestinal contents were passed through sieves. The collected worms were washed 3 times with sterile PBS and kept in RNAlater at −80°C until testing [20].

Total RNAs were isolated from the following parasites at different developmental stages in culture media: [A] evaginated protoscoleces (up to 1 day post cultivation), [B] juvenile worms with excretory canals and bladder formation (5–7 days), [C] juvenile worms with first proglottid formation (18–22 days), [D] juvenile worms with second proglottid formation (26–32 days), [E] juvenile worms with testes and genital pore appearance (34–36 days), [F] juvenile worms with 3 or more proglottid formation prior to embryonated egg production in diphasic culture medium, and [G] microcysts in monophasic culture medium. In addition, total RNAs were extracted from the following ex vivo stages: [H] invaginated protoscoleces, [I] germinal layer of hydatid cyst from infected sheep, and [J] adult worms isolated from the experimentally infected dog. Total RNAs from various stages were isolated using the RNeasy mini kit (QIAGEN GmbH) and the contaminating genomic DNA was removed from the RNA samples with DNaseI in a column digestion according to the manufacturer’s protocol. The quantity and quality of the RNA samples were assessed using the NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, Delaware, USA). Samples with concentrations >100 ng/μl, A260/A280 ratio between 1.8–2.0 and A260/A230 ratio of 1.7–2.0 were retained.

Total RNA (1 μg) was used to synthesize the first cDNA strand for each sample using the Omniscript® Reverse Transcriptase kit (QIAGEN GmbH) with random primers (Sigma-Aldrich) and a final volume of 20 μl. The final cDNA products were diluted 50 times with nuclease free water before qPCR.

Gene sequences obtained from the EMBL and GenBank databases were used to design specific primers for HoxB7 (EUB63018) and Notch (CDJ25139): HoxB7 (EgHoxB7_F GCGAACGCATCTGCGGG and EgHoxB7_R TTCTTCACCTTCATTGGAGG) and Notch (Egnotch_F: TCTGTCTACGGTGACGGTG and Egnotch_R: ACAGCACGGAGAAGGTCTG). The amplicon size was 237 and 215 bp, respectively.

Relative quantitation using SYBR green PCR Master Mix (QIAGEN GmbH) using 7.5 μl of diluted cDNA (1:50) as template per 15 μl reaction was performed using the Rotor-Gene Q (QIAGEN GmbH) as per the manufacturer’s instructions. The reaction conditions were initial activation at 94°C for 15 min, 45 cycles of denaturation at 94°C for 10 sec, annealing at 58°C for 15 sec, and extension at 72°C for 35 sec for each primer pair. The point of quantification was adjusted according to the melting curves of each primer pair. A dissociation step from 50°C to 94°C with ramping increments of 0.1°C/sec was added to assess the amplification specificity for each product through melting curve analyses. To determine the PCR amplification efficiency for each gene, standard cDNA dilutions were prepared using 5 two-fold serial dilutions. PCR results were normalized to the levels of TATA-Box binding protein (TBP), elongation factor 1 alpha (EF-1a), and cyclophilin (CYP-1) as reference genes [21]. The expression of all the selected developmental genes was evaluated using ΔΔCT method. There were 4 technical replicates per biological stage for each gene. For each run, a reverse transcription negative control (without reverse transcriptase) for each synthesized cDNA and a non-template negative control were included to confirm the absence of DNA contamination.

Data analysis was conducted by SPSS statistical package, version 17.0 (SPSS Inc., Chicago, Illinois, USA). One-way ANOVA test was used to assess the differences between the relative quantities of each gene. In addition, P<0.05 was considered statistically significant.

The results of partial amplification of cox1 segment showed a product size of 366 bp. Nucleotide sequences were aligned with the reference sequences of each genotype within E. granulosus retrieved from GenBank. The findings of sequence analysis of the collected protoscoleces demonstrated the presence of E. granulosus sensu stricto (G1 genotype).

The different stages of E. granulosus in diphasic culture medium were observed as follows: intact protoscoleces (Fig. 1A), evaginated protoscoleces (Fig. 1B), excretory canal and bladder formation (Fig. 1C), first proglottid formation (Fig. 1D), second proglottid formation and testes and genital pore appearance (Fig. 1E), and 3 or more proglottids formation (Fig. 1F). Parasite microcysts developed in monophasic culture medium after 45 days, which is depicted in Fig. 1G. The mature adult worms of E. granulosus with 3 proglottids were isolated from the small intestine of experimentally infected dogs 45 days post infection (data not shown).

The results showed that notch gene was expressed at all developmental stages of E. granulosus (Fig. 2). Nevertheless, the level of expression was significantly upregulated at vesicle (31.3-fold) and germinal layer (86.4-fold) stages in comparison with the other stages (P<0.001).

The expression of HoxB7 gene was observed at all developmental stages of E. granulosus (Fig. 2). The level of expression was significantly upregulated 9.0-fold in 3 or more proglottids formation (P<0.05), 9.4-fold in germinal layer (P<0.05) and 82.5-fold in adult worm stages (P<0.001).